Starting /dee2/code/volunteer_pipeline.sh SRR9668925 current disk space = 3052012298240 free memory = 1415783788 SRR9668925 SRAfilesize be3edaca32d0de2df3c61e527b398702 SRR9668925.sra SRR9668925.sra file validated SRR9668925 is paired end SRR9668925 is conventional basespace SRR9668925 read1 length is 57-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668925_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 57-76 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.56575 32.0 32.0 32.0 32.0 32.0 2 31.486 32.0 32.0 32.0 32.0 32.0 3 31.555 32.0 32.0 32.0 32.0 32.0 4 31.58225 32.0 32.0 32.0 32.0 32.0 5 31.59175 32.0 32.0 32.0 32.0 32.0 6 34.64275 36.0 36.0 36.0 36.0 36.0 7 35.24425 36.0 36.0 36.0 36.0 36.0 8 35.21825 36.0 36.0 36.0 36.0 36.0 9 35.2615 36.0 36.0 36.0 36.0 36.0 10-11 35.178124999999994 36.0 36.0 36.0 36.0 36.0 12-13 35.140875 36.0 36.0 36.0 36.0 36.0 14-15 35.104124999999996 36.0 36.0 36.0 36.0 36.0 16-17 35.133375 36.0 36.0 36.0 36.0 36.0 18-19 35.186 36.0 36.0 36.0 36.0 36.0 20-21 35.064375 36.0 36.0 36.0 36.0 36.0 22-23 35.028000000000006 36.0 36.0 36.0 36.0 36.0 24-25 35.053875000000005 36.0 36.0 36.0 36.0 36.0 26-27 35.002875 36.0 36.0 36.0 36.0 36.0 28-29 34.994749999999996 36.0 36.0 36.0 36.0 36.0 30-31 34.96 36.0 36.0 36.0 36.0 36.0 32-33 34.916375 36.0 36.0 36.0 34.0 36.0 34-35 34.931625 36.0 36.0 36.0 36.0 36.0 36-37 34.905125 36.0 36.0 36.0 36.0 36.0 38-39 34.893625 36.0 36.0 36.0 36.0 36.0 40-41 34.826875 36.0 36.0 36.0 36.0 36.0 42-43 34.826750000000004 36.0 36.0 36.0 36.0 36.0 44-45 34.75025 36.0 36.0 36.0 36.0 36.0 46-47 34.745125 36.0 36.0 36.0 34.0 36.0 48-49 34.79075 36.0 36.0 36.0 36.0 36.0 50-51 34.804625 36.0 36.0 36.0 34.0 36.0 52-53 34.688375 36.0 36.0 36.0 34.0 36.0 54-55 34.681 36.0 36.0 36.0 32.0 36.0 56-57 34.558125000000004 36.0 36.0 36.0 32.0 36.0 58-59 34.56189047261816 36.0 36.0 36.0 32.0 36.0 60-61 34.53138284571143 36.0 36.0 36.0 32.0 36.0 62-63 34.46011502875719 36.0 36.0 36.0 32.0 36.0 64-65 34.33754377188595 36.0 36.0 36.0 32.0 36.0 66-67 34.3336935543078 36.0 36.0 36.0 32.0 36.0 68-69 34.2510632974731 36.0 36.0 36.0 32.0 36.0 70-71 34.29221916437328 36.0 36.0 36.0 32.0 36.0 72-73 34.2441523804158 36.0 36.0 36.0 32.0 36.0 74-75 34.25095591488707 36.0 36.0 36.0 32.0 36.0 76 33.39893818733409 36.0 32.0 36.0 27.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 1.0 24 5.0 25 12.0 26 16.0 27 35.0 28 56.0 29 65.0 30 101.0 31 120.0 32 158.0 33 246.0 34 545.0 35 2638.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.775 13.600000000000001 10.6 42.025 2 20.875 17.2 38.7 23.225 3 19.55 21.325 25.324999999999996 33.800000000000004 4 22.325 30.349999999999998 22.2 25.124999999999996 5 22.575 34.2 24.4 18.825 6 19.842679522963717 33.49403704643492 27.37883785841157 19.2844455721898 7 14.274999999999999 24.75 43.55 17.424999999999997 8 18.25 21.75 32.05 27.950000000000003 9 17.875 23.375 34.2 24.55 10-11 20.8625 33.2375 23.1 22.8 12-13 20.549999999999997 24.3125 28.15 26.987499999999997 14-15 20.349999999999998 27.6125 27.1 24.9375 16-17 20.599999999999998 27.737499999999997 27.1625 24.5 18-19 20.2375 28.3375 26.825 24.6 20-21 21.2875 27.3 27.55 23.8625 22-23 21.375 27.05 27.950000000000003 23.625 24-25 20.415051881485187 27.21590198774847 26.95336917114639 25.415676959619955 26-27 20.4625 26.575 27.987499999999997 24.975 28-29 20.1875 27.962500000000002 26.7125 25.137500000000003 30-31 20.6125 27.950000000000003 26.875 24.5625 32-33 20.625 27.875 27.462500000000002 24.0375 34-35 21.3 27.900000000000002 27.5875 23.2125 36-37 20.5875 28.487499999999997 26.700000000000003 24.224999999999998 38-39 19.900000000000002 28.1375 26.5375 25.424999999999997 40-41 20.6875 29.025000000000002 26.1625 24.125 42-43 21.275 26.700000000000003 27.712500000000002 24.3125 44-45 20.200000000000003 27.537499999999998 27.35 24.9125 46-47 20.9 27.85 27.1375 24.1125 48-49 21.5 27.237499999999997 27.0875 24.175 50-51 20.925 27.425 27.3125 24.337500000000002 52-53 20.599999999999998 28.462500000000002 26.75 24.1875 54-55 20.7875 27.487499999999997 26.775 24.95 56-57 19.725 26.6125 27.3 26.3625 58-59 20.042510627656913 28.507126781695426 27.86946736684171 23.58089522380595 60-61 20.580145036259065 27.7569392348087 27.11927981995499 24.543635908977244 62-63 21.355338834708675 26.9567391847962 28.094523630907727 23.593398349587396 64-65 21.285642821410704 27.37618809404702 27.37618809404702 23.961980990495245 66-67 20.350218886804253 27.292057535959973 27.37961225766104 24.978111319574733 68-69 20.690517888416313 27.47060295221416 27.433074806104578 24.405804353264948 70-71 21.766324743557668 27.032774580935705 28.14610958218664 23.05479109331999 72-73 21.048002010555418 27.155064086453883 27.62000502638854 24.17692887660216 74-75 21.4934544483035 23.85786802030457 28.11915575741384 26.529521773978093 76 21.577550246492226 0.0 40.46264694728858 37.95980280621919 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.0 21 0.5 22 0.5 23 4.0 24 6.5 25 6.5 26 6.0 27 9.5 28 15.5 29 17.0 30 23.5 31 39.5 32 56.5 33 69.5 34 79.5 35 99.5 36 118.0 37 117.5 38 134.0 39 185.5 40 215.5 41 240.0 42 270.5 43 287.5 44 298.5 45 308.0 46 325.5 47 313.0 48 280.5 49 261.5 50 248.0 51 219.0 52 192.5 53 168.0 54 140.5 55 111.0 56 96.0 57 85.5 58 66.0 59 59.0 60 55.0 61 35.5 62 15.0 63 12.5 64 7.0 65 3.0 66 3.5 67 3.5 68 4.0 69 2.5 70 0.5 71 1.0 72 0.5 73 0.5 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 1.4749999999999999 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0125 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 57 1.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 1.0 64 0.0 65 0.0 66 1.0 67 0.0 68 0.0 69 0.0 70 0.0 71 6.0 72 24.0 73 90.0 74 268.0 75 972.0 76 2637.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.125 #Duplication Level Percentage of deduplicated Percentage of total 1 98.36942675159236 96.525 2 1.4012738853503186 2.75 3 0.17834394904458598 0.525 4 0.05095541401273885 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR9668925 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668925_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.11075 32.0 32.0 32.0 32.0 32.0 2 30.963 32.0 32.0 32.0 32.0 32.0 3 30.802 32.0 32.0 32.0 32.0 32.0 4 30.919 32.0 32.0 32.0 32.0 32.0 5 30.82475 32.0 32.0 32.0 32.0 32.0 6 34.19675 36.0 36.0 36.0 32.0 36.0 7 34.58625 36.0 36.0 36.0 32.0 36.0 8 34.33175 36.0 36.0 36.0 32.0 36.0 9 34.45725 36.0 36.0 36.0 32.0 36.0 10-11 34.34575 36.0 36.0 36.0 32.0 36.0 12-13 34.411875 36.0 36.0 36.0 32.0 36.0 14-15 34.28874999999999 36.0 36.0 36.0 32.0 36.0 16-17 34.340625 36.0 36.0 36.0 32.0 36.0 18-19 34.264250000000004 36.0 36.0 36.0 32.0 36.0 20-21 34.2555 36.0 36.0 36.0 32.0 36.0 22-23 34.211625 36.0 36.0 36.0 32.0 36.0 24-25 34.222375 36.0 36.0 36.0 32.0 36.0 26-27 34.19775 36.0 36.0 36.0 32.0 36.0 28-29 34.21075 36.0 36.0 36.0 32.0 36.0 30-31 34.082375 36.0 36.0 36.0 32.0 36.0 32-33 34.114125 36.0 36.0 36.0 32.0 36.0 34-35 34.093125 36.0 36.0 36.0 32.0 36.0 36-37 34.150212979203204 36.0 36.0 36.0 32.0 36.0 38-39 34.00801804059133 36.0 36.0 36.0 32.0 36.0 40-41 33.97406664996241 36.0 36.0 36.0 29.5 36.0 42-43 33.72243107769424 36.0 36.0 36.0 29.5 36.0 44-45 33.71245926297318 36.0 36.0 36.0 27.0 36.0 46-47 33.72900476309852 36.0 36.0 36.0 27.0 36.0 48-49 33.94748057157182 36.0 36.0 36.0 29.5 36.0 50-51 33.80960140386061 36.0 36.0 36.0 27.0 36.0 52-53 33.67786412634746 36.0 36.0 36.0 29.5 36.0 54-55 33.656806217097014 36.0 36.0 36.0 27.0 36.0 56-57 33.59551265981449 36.0 36.0 36.0 27.0 36.0 58-59 33.570962888665996 36.0 36.0 36.0 27.0 36.0 60-61 33.620309574321155 36.0 36.0 36.0 27.0 36.0 62-63 33.501254075746175 36.0 36.0 36.0 27.0 36.0 64-65 33.521073758153534 36.0 36.0 36.0 27.0 36.0 66-67 33.23522494980865 36.0 36.0 36.0 24.0 36.0 68-69 33.439021329987455 36.0 36.0 36.0 27.0 36.0 70-71 33.48745294855709 36.0 36.0 36.0 27.0 36.0 72-73 33.55685434894035 36.0 36.0 36.0 27.0 36.0 74-75 33.52221953924142 36.0 36.0 36.0 27.0 36.0 76 32.42998417721519 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 2.0 11 0.0 12 0.0 13 0.0 14 1.0 15 2.0 16 2.0 17 3.0 18 7.0 19 7.0 20 8.0 21 9.0 22 10.0 23 22.0 24 32.0 25 38.0 26 47.0 27 67.0 28 78.0 29 103.0 30 123.0 31 141.0 32 232.0 33 315.0 34 658.0 35 2084.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.43358395989975 20.827067669172934 14.260651629072681 31.47869674185464 2 27.48684540215485 26.98571786519669 32.22250062640942 13.304936106239037 3 21.748935103983964 27.536958155850666 28.138311200200448 22.575795539964922 4 24.605362064645455 34.05161613630669 21.44825858180907 19.894763217238786 5 25.181658732147334 35.95590077674768 21.874216988223502 16.988223502881482 6 21.122525682786268 36.933099473816085 21.92432974191932 20.020045101478328 7 20.79679278376347 19.143071911801552 39.062891505888246 20.99724379854673 8 23.076923076923077 23.277374091706342 27.436732648459035 26.20897018291155 9 24.40491104986219 24.27962916562265 28.138311200200448 23.177148584314708 10-11 25.35705337008269 31.257830117764975 22.726133801052367 20.658982711099974 12-13 25.169130543723377 24.31721373089451 27.035830618892508 23.477825106489604 14-15 23.408521303258144 27.681704260651628 27.456140350877195 21.453634085213032 16-17 24.63023314113813 27.513161193281526 25.871145650538985 21.985460015041365 18-19 23.202204961162614 28.16336757704836 26.685041343021798 21.949386118767226 20-21 23.809523809523807 27.54385964912281 26.14035087719298 22.506265664160402 22-23 24.241664577588367 27.625971421408874 26.736024066182 21.39633993482076 24-25 23.859649122807017 27.368421052631582 26.666666666666668 22.105263157894736 26-27 24.830869456276623 27.461789025306942 26.10874467551992 21.598596842896516 28-29 24.291802456756077 27.66357483078466 26.247179744296815 21.797442968162446 30-31 24.614420062695924 27.699059561128525 26.545454545454543 21.141065830721004 32-33 23.90323389320632 27.776385058912005 26.44773126096766 21.872649786914014 34-35 24.43274413940078 26.8145919518616 27.065312774225898 21.68735113451172 36-37 23.491027732463294 27.130129250847034 27.142677876772492 22.23616513991718 38-39 24.020100502512562 27.248743718592966 27.248743718592966 21.482412060301506 40-41 25.062940584088622 26.800100704934543 26.938569989929505 21.19838872104733 42-43 24.24051430732384 27.883524517836882 26.53472834993067 21.34123282490861 44-45 24.271109428246877 26.227439101350498 27.931339139214945 21.570112331187683 46-47 25.94553706505295 26.525466464952093 27.18103883005547 20.347957639939484 48-49 23.43043696634857 27.812656956303368 27.096936212958312 21.65996986438975 50-51 24.522852837769964 27.636865896534406 26.13008538422903 21.7101958814666 52-53 24.400050257570047 27.327553712777984 25.882648573941452 22.389747455710516 54-55 24.36784501195119 27.04742734935212 26.0787520442823 22.505975594414394 56-57 23.65171370967742 26.953125 27.21774193548387 22.177419354838708 58-59 24.911794354838708 27.21774193548387 26.28528225806452 21.585181451612904 60-61 24.26562892292242 27.529500376600552 26.36203866432337 21.842832036153652 62-63 24.971737218942344 27.333249591759827 26.516769250094207 21.178243939203618 64-65 24.779652480483506 27.13422311760262 26.189876605389074 21.896247796524804 66-67 24.666162761400855 27.727387251196774 26.492819349962204 21.11363063744016 68-69 25.13839959738299 27.21439355812783 26.421741318570707 21.22546552591847 70-71 25.009416195856875 26.892655367231637 26.854990583804145 21.242937853107343 72-73 25.523857611714213 26.558949760161575 26.659934360010094 21.257258268114114 74-75 24.979811574697173 23.553162853297444 27.711978465679678 23.75504710632571 76 27.513855898654 0.0 40.45922406967538 32.02692003167063 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 9.0 1 4.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 1.0 14 2.0 15 1.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 3.5 23 6.0 24 8.5 25 8.5 26 8.5 27 10.5 28 10.5 29 13.0 30 19.0 31 28.5 32 41.5 33 51.5 34 59.0 35 80.5 36 107.0 37 120.0 38 133.0 39 180.0 40 235.0 41 263.0 42 285.0 43 295.0 44 311.0 45 317.0 46 309.0 47 304.5 48 283.0 49 248.5 50 216.5 51 198.5 52 183.5 53 146.0 54 113.5 55 107.0 56 98.5 57 81.0 58 67.5 59 63.5 60 50.5 61 35.5 62 31.5 63 22.0 64 11.0 65 6.5 66 6.5 67 10.5 68 9.5 69 7.0 70 5.0 71 3.5 72 3.0 73 2.0 74 0.5 75 0.0 76 0.5 77 1.0 78 1.0 79 1.0 80 0.5 81 1.0 82 1.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.5 96 1.0 97 1.0 98 1.5 99 13.5 100 25.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.22499999999999998 3 0.22499999999999998 4 0.22499999999999998 5 0.22499999999999998 6 0.22499999999999998 7 0.22499999999999998 8 0.22499999999999998 9 0.22499999999999998 10-11 0.22499999999999998 12-13 0.22499999999999998 14-15 0.25 16-17 0.27499999999999997 18-19 0.22499999999999998 20-21 0.25 22-23 0.27499999999999997 24-25 0.25 26-27 0.22499999999999998 28-29 0.27499999999999997 30-31 0.3125 32-33 0.27499999999999997 34-35 0.2875 36-37 0.16286644951140067 38-39 0.2756201453269857 40-41 0.476071160110248 42-43 0.5889724310776943 44-45 0.689395838556029 46-47 0.576585610428679 48-49 0.17548257708698922 50-51 0.17548257708698922 52-53 0.23815492604662825 54-55 0.36349962396590624 56-57 0.5264477312609677 58-59 0.5015045135406219 60-61 0.11285266457680251 62-63 0.16302984700275897 64-65 0.3763171098845961 66-67 0.41400075272864134 68-69 0.27603513174404015 70-71 0.06273525721455457 72-73 0.1134787542554533 74-75 0.053806833467850416 76 0.07911392405063292 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 9.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 1.0 42 0.0 43 1.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 1.0 58 0.0 59 0.0 60 1.0 61 0.0 62 0.0 63 1.0 64 0.0 65 0.0 66 1.0 67 0.0 68 0.0 69 0.0 70 0.0 71 5.0 72 29.0 73 88.0 74 292.0 75 1043.0 76 2528.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.8 #Duplication Level Percentage of deduplicated Percentage of total 1 98.72188139059304 96.55 2 1.0736196319018405 2.1 3 0.1278118609406953 0.375 4 0.025562372188139063 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025562372188139063 0.22499999999999998 >10 0.025562372188139063 0.65 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 26 0.65 No Hit NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 9 0.22499999999999998 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1844444 spots for SRR9668925.sra Written 1844444 spots for SRR9668925.sra Read 1844444 spots for SRR9668925.sra Written 1844444 spots for SRR9668925.sra Read 1844444 spots for SRR9668925.sra Written 1844444 spots for SRR9668925.sra Read 1844444 spots for SRR9668925.sra Written 1844444 spots for SRR9668925.sra Read 1844444 spots for SRR9668925.sra Written 1844444 spots for SRR9668925.sra Read 1844444 spots for SRR9668925.sra Written 1844444 spots for SRR9668925.sra Read 1844444 spots for SRR9668925.sra Written 1844444 spots for SRR9668925.sra Read 1844444 spots for SRR9668925.sra Written 1844444 spots for SRR9668925.sra Read 1844444 spots for SRR9668925.sra Written 1844444 spots for SRR9668925.sra Read 1844444 spots for SRR9668925.sra Written 1844444 spots for SRR9668925.sra Read 1844444 spots for SRR9668925.sra Written 1844444 spots for SRR9668925.sra Read 1844444 spots for SRR9668925.sra Written 1844444 spots for SRR9668925.sra Read 1844444 spots for SRR9668925.sra Written 1844444 spots for SRR9668925.sra Read 1844444 spots for SRR9668925.sra Written 1844444 spots for SRR9668925.sra Read 1844444 spots for SRR9668925.sra Written 1844444 spots for SRR9668925.sra Read 1844444 spots for SRR9668925.sra Written 1844444 spots for SRR9668925.sra Read 1844444 spots for SRR9668925.sra Written 1844444 spots for SRR9668925.sra Read 1844444 spots for SRR9668925.sra Written 1844444 spots for SRR9668925.sra Read 1844445 spots for SRR9668925.sra Written 1844445 spots for SRR9668925.sra Read 1844444 spots for SRR9668925.sra Written 1844444 spots for SRR9668925.sra SRR ids: ['SRR9668925.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nida34jz SRR9668925.sra spots: 36888881 blocks: [[1, 1844444], [1844445, 3688888], [3688889, 5533332], [5533333, 7377776], [7377777, 9222220], [9222221, 11066664], [11066665, 12911108], [12911109, 14755552], [14755553, 16599996], [16599997, 18444440], [18444441, 20288884], [20288885, 22133328], [22133329, 23977772], [23977773, 25822216], [25822217, 27666660], [27666661, 29511104], [29511105, 31355548], [31355549, 33199992], [33199993, 35044436], [35044437, 36888881]] SRR9668925 file size 7003751 SRR9668925 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR9668925 SRR9668925_1.fastq SRR9668925_2.fastq Input file: SRR9668925_1.fastq Paired file: SRR9668925_2.fastq trimmed: SRR9668925-trimmed-pair1.fastq, SRR9668925-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 16:44:23 2025 >> started Wed Feb 12 16:45:14 2025 >> done (51.477s) 36888881 read pairs processed; of these: 23 ( 0.00%) short read pairs filtered out after trimming by size control 4350 ( 0.01%) empty read pairs filtered out after trimming by size control 36884508 (99.99%) read pairs available; of these: 6437 ( 0.02%) trimmed read pairs available after processing 36878071 (99.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 1 0.00% 21 0 0.00% 22 3 0.00% 23 5 0.00% 24 11 0.00% 25 9 0.00% 26 17 0.00% 27 20 0.00% 28 20 0.00% 29 15 0.00% 30 18 0.00% 31 21 0.00% 32 25 0.00% 33 23 0.00% 34 35 0.00% 35 148 0.00% 36 170 0.00% 37 156 0.00% 38 206 0.00% 39 226 0.00% 40 250 0.00% 41 229 0.00% 42 297 0.00% 43 326 0.00% 44 373 0.00% 45 382 0.00% 46 331 0.00% 47 412 0.00% 48 501 0.00% 49 486 0.00% 50 629 0.00% 51 811 0.00% 52 743 0.00% 53 758 0.00% 54 867 0.00% 55 1267 0.00% 56 1233 0.00% 57 1252 0.00% 58 1359 0.00% 59 1460 0.00% 60 1607 0.00% 61 1565 0.00% 62 1727 0.00% 63 1873 0.01% 64 2084 0.01% 65 2256 0.01% 66 2345 0.01% 67 2710 0.01% 68 2697 0.01% 69 3125 0.01% 70 4400 0.01% 71 6763 0.02% 72 26105 0.07% 73 320353 0.87% 74 3039701 8.24% 75 17851484 48.40% 76 15598617 42.29% 36884508 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=33 prefix-density=0.22 prefix-fanout=1.9 sequence=GTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=39.13 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=7.3 sequence=TGCTGCTGCTGCATTTATTAGAGAAGGAGATGCTGGTAATCTCCATTTCACAAGTTCATTAATCTCGATCGAAAATATGGCTCATTTAAGCATATACAAAGTACATCTGGGAAAGAAAGTTAAGAACCAAGATAGGGTCACTGATATTTGGATGATGTTCATACGGAGAGGGAGGGAGAAAGGCTGTACTCAAGCCCCCAGAGCTCAAAACTGCCTTTGACAAAATCATAATAACCACCCTTCAGTCCTAGAGTTTTGTTCACCAAGCCATCTCTCACAAACGGGTAGGTTAGCAAGTGTCCAAGGGACACGTTCACTGCCTCCTTTTCACATTGTGTACAGAGGTCTGGGAAAGGTGCATTGGCATGTTCTGCTAAAACCTTAGTCTTGGCAGGGTAGCAAACTTTGACCCAGTCTTCTATGAAATCAGTTGATGTTGTTCCATCA criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=27 prefix-density=0.27 prefix-fanout=1.9 sequence=GAGTTCAATGCATGCAGGTGTGGCCTCCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACTACTGAGCAATTGGCCCAGGAAATTGAGTACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTGAGCTCGAGGAGGCGAAGAAAGCTTACCCTAACTCCTTTATCCGTATCATTGGATTCGACAACACTCGTCAAGTGCAGTGCATCAGTTTTATCGCCTCCAAGCCGAAGGGTGTCTAGGTTCCAAGATTTGATGAGTCCCTAGCTA criterion=fanout-score sequence-density=0.03 sequence-density-rank=28 fanout-score=16.15 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=3.2 sequence=CAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR9668925 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 16:45:52 Started mapping on | Feb 12 16:45:52 Finished on | Feb 12 16:48:42 Mapping speed, Million of reads per hour | 781.08 Number of input reads | 36884508 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 31958449 Uniquely mapped reads % | 86.64% Average mapped length | 150.41 Number of splices: Total | 14418917 Number of splices: Annotated (sjdb) | 14257834 Number of splices: GT/AG | 14165231 Number of splices: GC/AG | 215153 Number of splices: AT/AC | 10481 Number of splices: Non-canonical | 28052 Mismatch rate per base, % | 0.49% Deletion rate per base | 0.02% Deletion average length | 2.18 Insertion rate per base | 0.01% Insertion average length | 1.96 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1536515 % of reads mapped to multiple loci | 4.17% Number of reads mapped to too many loci | 2200214 % of reads mapped to too many loci | 5.97% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.94% % of reads unmapped: other | 0.28% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3389591 3389591 3389591 N_multimapping 1536515 1536515 1536515 N_noFeature 1073943 31574354 1186391 N_ambiguous 444762 1640 171835 UnstrandedReadsAssigned:30439744 PositiveStrandReadsAssigned:382455 NegativeStrandReadsAssigned:30600223 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR9668925 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR9668925-trimmed-pair1.fastq SRR9668925-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 36,884,508 reads, 32,944,167 reads pseudoaligned [quant] estimated average fragment length: 207.244 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,083 rounds 52401 SRR9668925.ke.tsv 34699 SRR9668925.se.tsv 87100 total ==> SRR9668925.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1811.76 668 9.47132 Potri.005G024800.1.v4.1 1035 828.756 112 3.47156 Potri.004G059700.1.v4.1 961 754.77 60 2.04207 Potri.007G009000.2.v4.1 1416 1209.76 0 0 Potri.003G141000.2.v4.1 2943 2736.76 562.481 5.27965 Potri.016G087400.1.v4.1 270 85.9632 2216.92 662.477 Potri.015G069301.1.v4.1 564 358.112 0 0 Potri.010G195200.1.v4.1 1773 1566.76 12 0.196749 Potri.012G127500.1.v4.1 977 770.77 8757 291.853 ==> SRR9668925.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 40 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 438 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 211 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 16 SRR9668925 completed mapping pipeline successfully