Starting /dee2/code/volunteer_pipeline.sh SRR9668926 current disk space = 3051940605952 free memory = 1443846524 SRR9668926 SRAfilesize d029400b1a9374e54e45565f640e18ef SRR9668926.sra SRR9668926.sra file validated SRR9668926 is paired end SRR9668926 is conventional basespace SRR9668926 read1 length is 52-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668926_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52-76 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.579 32.0 32.0 32.0 32.0 32.0 2 31.44825 32.0 32.0 32.0 32.0 32.0 3 31.5855 32.0 32.0 32.0 32.0 32.0 4 31.56825 32.0 32.0 32.0 32.0 32.0 5 31.629 32.0 32.0 32.0 32.0 32.0 6 34.6945 36.0 36.0 36.0 36.0 36.0 7 35.19825 36.0 36.0 36.0 36.0 36.0 8 35.22825 36.0 36.0 36.0 36.0 36.0 9 35.2125 36.0 36.0 36.0 36.0 36.0 10-11 35.1755 36.0 36.0 36.0 36.0 36.0 12-13 35.127125 36.0 36.0 36.0 36.0 36.0 14-15 35.10225 36.0 36.0 36.0 36.0 36.0 16-17 35.253 36.0 36.0 36.0 36.0 36.0 18-19 35.252250000000004 36.0 36.0 36.0 36.0 36.0 20-21 35.07875 36.0 36.0 36.0 36.0 36.0 22-23 35.025999999999996 36.0 36.0 36.0 36.0 36.0 24-25 35.06675 36.0 36.0 36.0 36.0 36.0 26-27 34.947375 36.0 36.0 36.0 36.0 36.0 28-29 35.00212500000001 36.0 36.0 36.0 36.0 36.0 30-31 35.008375 36.0 36.0 36.0 36.0 36.0 32-33 34.899 36.0 36.0 36.0 36.0 36.0 34-35 34.944375 36.0 36.0 36.0 36.0 36.0 36-37 34.845625 36.0 36.0 36.0 34.0 36.0 38-39 35.054125 36.0 36.0 36.0 36.0 36.0 40-41 34.869875 36.0 36.0 36.0 36.0 36.0 42-43 34.8605 36.0 36.0 36.0 36.0 36.0 44-45 34.900625000000005 36.0 36.0 36.0 36.0 36.0 46-47 34.788375 36.0 36.0 36.0 36.0 36.0 48-49 34.802875 36.0 36.0 36.0 36.0 36.0 50-51 34.866 36.0 36.0 36.0 36.0 36.0 52-53 34.77172277444361 36.0 36.0 36.0 34.0 36.0 54-55 34.688422105526385 36.0 36.0 36.0 32.0 36.0 56-57 34.678794698674665 36.0 36.0 36.0 32.0 36.0 58-59 34.759814953738434 36.0 36.0 36.0 32.0 36.0 60-61 34.62690672668167 36.0 36.0 36.0 32.0 36.0 62-63 34.50475118779695 36.0 36.0 36.0 32.0 36.0 64-65 34.49581583114638 36.0 36.0 36.0 32.0 36.0 66-67 34.477671191112194 36.0 36.0 36.0 32.0 36.0 68-69 34.52476857643232 36.0 36.0 36.0 32.0 36.0 70-71 34.38134240695537 36.0 36.0 36.0 32.0 36.0 72-73 34.43322125020772 36.0 36.0 36.0 32.0 36.0 74-75 34.31205399251566 36.0 36.0 36.0 32.0 36.0 76 33.68449197860963 36.0 32.0 36.0 32.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 0.0 24 8.0 25 12.0 26 26.0 27 34.0 28 46.0 29 66.0 30 87.0 31 111.0 32 114.0 33 216.0 34 572.0 35 2706.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.875 12.049999999999999 10.100000000000001 42.975 2 21.3 17.224999999999998 38.2 23.275000000000002 3 19.025 20.150000000000002 24.8 36.025 4 21.349999999999998 31.7 21.224999999999998 25.724999999999998 5 22.15 33.475 23.775 20.599999999999998 6 19.78744939271255 34.89372469635627 24.79757085020243 20.521255060728745 7 15.024999999999999 23.025000000000002 43.675000000000004 18.275 8 16.950000000000003 24.099999999999998 32.15 26.8 9 17.875 23.674999999999997 34.075 24.375 10-11 20.95 31.112499999999997 24.3625 23.575 12-13 20.3 26.437500000000004 27.3625 25.900000000000002 14-15 19.7125 28.275 27.987499999999997 24.025 16-17 20.6125 27.712500000000002 27.575 24.099999999999998 18-19 20.4125 28.1625 26.9125 24.5125 20-21 19.8375 28.1875 27.487499999999997 24.4875 22-23 20.75 28.1125 27.1375 24.0 24-25 20.5875 27.3625 27.625 24.425 26-27 21.3 27.187499999999996 27.712500000000002 23.799999999999997 28-29 20.8125 27.762500000000003 27.6625 23.7625 30-31 19.7625 28.1625 26.8 25.275 32-33 20.95 27.750000000000004 27.6875 23.6125 34-35 21.575 28.787499999999998 26.525 23.1125 36-37 20.474999999999998 27.962500000000002 26.8 24.762500000000003 38-39 20.674999999999997 28.025 27.5125 23.7875 40-41 20.525 28.1875 26.974999999999998 24.3125 42-43 20.9125 28.212500000000002 27.0125 23.8625 44-45 20.424999999999997 27.6625 27.575 24.337500000000002 46-47 21.15 28.6875 26.974999999999998 23.1875 48-49 20.225 28.449999999999996 26.987499999999997 24.337500000000002 50-51 20.549999999999997 27.575 27.875 24.0 52-53 21.077634704338042 28.066008251031377 27.57844730591324 23.27790973871734 54-55 20.43010752688172 28.044511127781945 26.76919229807452 24.756189047261813 56-57 20.86771692923231 26.969242310577645 27.719429857464366 24.44361090272568 58-59 21.017754438609654 28.19454863715929 26.231557889472366 24.55613903475869 60-61 21.167791947987 27.069267316829208 26.18154538634659 25.581395348837212 62-63 21.267816954238562 27.25681420355089 26.906726681670417 24.568642160540136 64-65 20.595223208703263 28.585719644866824 26.722520945354507 24.096536201075402 66-67 21.138211382113823 27.6172607879925 26.85428392745466 24.390243902439025 68-69 21.503627720790593 27.157868401300977 26.832624468351263 24.505879409557167 70-71 20.780683097710497 28.037032403352935 27.599149255598647 23.58313524333792 72-73 21.588338778587584 27.74566473988439 26.514199547625033 24.151796933902993 74-75 21.065922381711854 23.96331738437002 28.827751196172247 26.14300903774588 76 20.77922077922078 0.0 41.711229946524064 37.50954927425516 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 1.0 18 0.5 19 0.5 20 2.0 21 3.0 22 1.5 23 1.0 24 3.5 25 6.0 26 8.5 27 9.0 28 14.0 29 24.0 30 32.0 31 41.0 32 52.0 33 55.5 34 75.5 35 100.5 36 121.0 37 140.5 38 160.0 39 183.5 40 215.5 41 262.0 42 287.5 43 284.5 44 286.5 45 300.5 46 308.5 47 302.5 48 288.0 49 272.5 50 252.0 51 224.5 52 196.5 53 160.0 54 134.0 55 112.0 56 88.0 57 75.0 58 64.0 59 55.5 60 42.5 61 30.5 62 18.0 63 13.5 64 11.5 65 6.5 66 3.0 67 3.0 68 3.0 69 2.5 70 1.5 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 1.2 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 52 1.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 1.0 65 0.0 66 1.0 67 0.0 68 0.0 69 0.0 70 1.0 71 5.0 72 24.0 73 82.0 74 246.0 75 1021.0 76 2618.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.875 #Duplication Level Percentage of deduplicated Percentage of total 1 98.98862199747155 97.875 2 0.9102402022756004 1.7999999999999998 3 0.07585335018963338 0.22499999999999998 4 0.025284450063211124 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR9668926 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668926_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.32225 32.0 32.0 32.0 32.0 32.0 2 31.085 32.0 32.0 32.0 32.0 32.0 3 31.064 32.0 32.0 32.0 32.0 32.0 4 30.99875 32.0 32.0 32.0 32.0 32.0 5 30.9995 32.0 32.0 32.0 32.0 32.0 6 34.5125 36.0 36.0 36.0 32.0 36.0 7 34.64075 36.0 36.0 36.0 32.0 36.0 8 34.533 36.0 36.0 36.0 32.0 36.0 9 34.433 36.0 36.0 36.0 32.0 36.0 10-11 34.446875000000006 36.0 36.0 36.0 32.0 36.0 12-13 34.399125 36.0 36.0 36.0 32.0 36.0 14-15 34.419624999999996 36.0 36.0 36.0 32.0 36.0 16-17 34.356375 36.0 36.0 36.0 32.0 36.0 18-19 34.411249999999995 36.0 36.0 36.0 32.0 36.0 20-21 34.424125000000004 36.0 36.0 36.0 32.0 36.0 22-23 34.33475 36.0 36.0 36.0 32.0 36.0 24-25 34.367374999999996 36.0 36.0 36.0 32.0 36.0 26-27 34.296375 36.0 36.0 36.0 32.0 36.0 28-29 34.284875 36.0 36.0 36.0 32.0 36.0 30-31 34.19825 36.0 36.0 36.0 32.0 36.0 32-33 34.33425 36.0 36.0 36.0 32.0 36.0 34-35 34.150625 36.0 36.0 36.0 32.0 36.0 36-37 34.24336504757136 36.0 36.0 36.0 32.0 36.0 38-39 34.15623435152729 36.0 36.0 36.0 32.0 36.0 40-41 34.113420130195294 36.0 36.0 36.0 32.0 36.0 42-43 33.91558338941846 36.0 36.0 36.0 29.5 36.0 44-45 33.969548872180454 36.0 36.0 36.0 32.0 36.0 46-47 34.05726817042607 36.0 36.0 36.0 32.0 36.0 48-49 34.0110275689223 36.0 36.0 36.0 32.0 36.0 50-51 33.974680371020305 36.0 36.0 36.0 32.0 36.0 52-53 33.81762346452745 36.0 36.0 36.0 32.0 36.0 54-55 33.78340436199549 36.0 36.0 36.0 32.0 36.0 56-57 33.874404612684884 36.0 36.0 36.0 32.0 36.0 58-59 33.77839057407871 36.0 36.0 36.0 29.5 36.0 60-61 33.77813988468288 36.0 36.0 36.0 27.0 36.0 62-63 33.759588869390825 36.0 36.0 36.0 27.0 36.0 64-65 33.71531233208273 36.0 36.0 36.0 27.0 36.0 66-67 33.64606318956871 36.0 36.0 36.0 27.0 36.0 68-69 33.6824222668004 36.0 36.0 36.0 27.0 36.0 70-71 33.704533759331184 36.0 36.0 36.0 27.0 36.0 72-73 33.61628454927892 36.0 36.0 36.0 27.0 36.0 74-75 33.59372485064232 36.0 36.0 36.0 27.0 36.0 76 32.379296875 36.0 32.0 36.0 21.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 3.0 11 0.0 12 0.0 13 0.0 14 3.0 15 4.0 16 6.0 17 8.0 18 5.0 19 5.0 20 12.0 21 9.0 22 9.0 23 15.0 24 21.0 25 40.0 26 33.0 27 63.0 28 67.0 29 80.0 30 105.0 31 153.0 32 176.0 33 308.0 34 658.0 35 2211.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.75125376128385 21.339017051153462 14.44332998996991 30.466399197592782 2 28.83988975194187 28.46404409922325 30.66900526183914 12.02706088699574 3 21.63786626596544 27.89882294014525 28.524918607563237 21.93839218632607 4 25.463194792188283 32.97446169253881 22.43365047571357 19.128693039559337 5 25.938908362543817 36.029043565348026 20.70605908863295 17.325988983475213 6 21.031547320981474 36.68002003004507 22.483725588382576 19.804707060590886 7 21.28192288432649 19.804707060590886 37.58137205808713 21.331997996995494 8 23.00951427140711 24.41161742613921 27.566349524286434 25.01251877816725 9 22.058087130696045 23.28492739108663 29.41912869303956 25.237856785177765 10-11 25.150225338007008 30.67100650976465 22.458688032048073 21.72008012018027 12-13 25.10015022533801 25.200300450676018 26.727591387080622 22.97195793690536 14-15 24.63060355622339 27.08489857250188 25.97044828449787 22.31404958677686 16-17 25.05951635133442 27.7032953264002 26.199724345320135 21.037463976945244 18-19 24.511767651477214 26.752628943415125 27.203304957436153 21.532298447671508 20-21 24.19536631183469 26.950532247964937 26.424546023794615 22.429555416405762 22-23 24.047619047619047 28.82205513784461 25.902255639097742 21.228070175438596 24-25 23.994990607388857 28.490920475892302 26.136505948653728 21.377582968065123 26-27 24.98748122183275 27.290936404606907 25.951427140711065 21.770155232849273 28-29 24.85904022052374 27.10186693396817 27.014158626738507 21.024934218769577 30-31 23.184952978056426 27.87460815047022 26.846394984326018 22.094043887147336 32-33 24.693059383613132 27.349035329491358 25.920821849160614 22.037083437734903 34-35 25.084575867685754 27.23969427390051 26.951509835860165 20.724220022553567 36-37 24.206299410214584 27.945789936002008 25.536453758313467 22.31145689546995 38-39 24.14312617702448 27.45762711864407 27.53295668549906 20.86629001883239 40-41 24.679728711379052 28.03315749811605 25.747299673448882 21.539814117056018 42-43 24.817793415431012 27.594873083689368 26.275446091982914 21.311887408896705 44-45 24.298124134458014 27.697343572957323 25.909605942339166 22.0949263502455 46-47 23.93108651911469 28.00553319919517 26.42102615694165 21.642354124748493 48-49 23.92969240426868 27.771500313873194 26.817325800376647 21.48148148148148 50-51 24.91214859437751 26.53112449799197 27.183734939759034 21.372991967871485 52-53 24.736313410346558 28.02611752887996 26.381215469613263 20.85635359116022 54-55 24.453654860587793 27.19166038683748 27.128862094951018 21.225822657623713 56-57 25.40520165849981 27.239602965196635 25.618796331197384 21.736399045106168 58-59 23.608493529337856 28.370398291242623 27.01344389998744 21.00766427943209 60-61 24.243945287990964 27.40619902120718 26.276822687915676 22.073033002886184 62-63 24.68934354211121 26.71017949039789 27.48838960712941 21.112087360361492 64-65 24.280869237532972 26.68006531842733 26.780555206632332 22.25851023740736 66-67 23.819095477386934 28.78140703517588 26.13065326633166 21.268844221105528 68-69 24.53849051864875 27.7784754489514 26.547783498681397 21.135250533718448 70-71 25.13181019332162 27.918654280692945 25.897564649761485 21.05197087622395 72-73 24.737839545167404 27.45420088439672 26.595072646873025 21.212886923562856 74-75 24.530595704444146 24.030798325003378 28.83965959746049 22.59894637309199 76 27.727806022682834 0.0 38.63903011341416 33.63316386390301 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 6.0 1 3.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 1.0 12 1.0 13 1.0 14 3.0 15 2.5 16 0.0 17 0.5 18 0.5 19 0.5 20 1.5 21 2.0 22 2.0 23 1.5 24 1.5 25 3.0 26 7.0 27 9.5 28 11.0 29 14.0 30 19.5 31 27.5 32 34.0 33 37.0 34 49.0 35 74.5 36 103.5 37 123.0 38 148.5 39 185.0 40 222.5 41 257.5 42 277.0 43 314.5 44 345.0 45 336.0 46 319.5 47 303.5 48 293.5 49 280.5 50 254.5 51 219.5 52 180.5 53 139.5 54 113.5 55 109.0 56 100.0 57 83.5 58 67.5 59 50.0 60 42.5 61 30.5 62 15.5 63 12.5 64 9.5 65 6.5 66 5.0 67 4.5 68 3.5 69 2.5 70 1.5 71 1.5 72 1.0 73 2.0 74 1.5 75 0.5 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 2.0 89 1.5 90 0.5 91 0.5 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 1.5 98 2.0 99 10.5 100 20.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.22499999999999998 3 0.17500000000000002 4 0.15 5 0.15 6 0.15 7 0.15 8 0.15 9 0.15 10-11 0.15 12-13 0.15 14-15 0.17500000000000002 16-17 0.2375 18-19 0.15 20-21 0.1875 22-23 0.25 24-25 0.1875 26-27 0.15 28-29 0.2375 30-31 0.3125 32-33 0.22499999999999998 34-35 0.2375 36-37 0.23785678517776665 38-39 0.28793189784677015 40-41 0.3254882323485228 42-43 0.33813400125234816 44-45 0.46365914786967416 46-47 0.3508771929824561 48-49 0.18796992481203006 50-51 0.12534469791927802 52-53 0.17548257708698922 54-55 0.2005515166708448 56-57 0.23815492604662825 58-59 0.23815492604662825 60-61 0.11281022812735021 62-63 0.1378791677112058 64-65 0.20057665789143786 66-67 0.20060180541624875 68-69 0.1629889669007021 70-71 0.1003260596940055 72-73 0.12618296529968456 74-75 0.09446693657219972 76 0.1171875 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 6.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 1.0 42 1.0 43 2.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 1.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 1.0 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 2.0 71 9.0 72 29.0 73 101.0 74 284.0 75 1003.0 76 2560.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.32499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.98296465802187 97.32499999999999 2 0.889905924230867 1.7500000000000002 3 0.07627765064836003 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.02542588354945334 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02542588354945334 0.5499999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 22 0.5499999999999999 No Hit NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1575866 spots for SRR9668926.sra Written 1575866 spots for SRR9668926.sra Read 1575866 spots for SRR9668926.sra Written 1575866 spots for SRR9668926.sra Read 1575866 spots for SRR9668926.sra Written 1575866 spots for SRR9668926.sra Read 1575866 spots for SRR9668926.sra Written 1575866 spots for SRR9668926.sra Read 1575866 spots for SRR9668926.sra Written 1575866 spots for SRR9668926.sra Read 1575866 spots for SRR9668926.sra Written 1575866 spots for SRR9668926.sra Read 1575866 spots for SRR9668926.sra Written 1575866 spots for SRR9668926.sra Read 1575866 spots for SRR9668926.sra Written 1575866 spots for SRR9668926.sra Read 1575871 spots for SRR9668926.sra Written 1575871 spots for SRR9668926.sra Read 1575866 spots for SRR9668926.sra Written 1575866 spots for SRR9668926.sra Read 1575866 spots for SRR9668926.sra Written 1575866 spots for SRR9668926.sra Read 1575866 spots for SRR9668926.sra Written 1575866 spots for SRR9668926.sra Read 1575866 spots for SRR9668926.sra Written 1575866 spots for SRR9668926.sra Read 1575866 spots for SRR9668926.sra Written 1575866 spots for SRR9668926.sra Read 1575866 spots for SRR9668926.sra Written 1575866 spots for SRR9668926.sra Read 1575866 spots for SRR9668926.sra Written 1575866 spots for SRR9668926.sra Read 1575866 spots for SRR9668926.sra Written 1575866 spots for SRR9668926.sra Read 1575866 spots for SRR9668926.sra Written 1575866 spots for SRR9668926.sra Read 1575866 spots for SRR9668926.sra Written 1575866 spots for SRR9668926.sra Read 1575866 spots for SRR9668926.sra Written 1575866 spots for SRR9668926.sra SRR ids: ['SRR9668926.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3kp1985x SRR9668926.sra spots: 31517325 blocks: [[1, 1575866], [1575867, 3151732], [3151733, 4727598], [4727599, 6303464], [6303465, 7879330], [7879331, 9455196], [9455197, 11031062], [11031063, 12606928], [12606929, 14182794], [14182795, 15758660], [15758661, 17334526], [17334527, 18910392], [18910393, 20486258], [20486259, 22062124], [22062125, 23637990], [23637991, 25213856], [25213857, 26789722], [26789723, 28365588], [28365589, 29941454], [29941455, 31517325]] SRR9668926 file size 5980665 SRR9668926 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR9668926 SRR9668926_1.fastq SRR9668926_2.fastq Input file: SRR9668926_1.fastq Paired file: SRR9668926_2.fastq trimmed: SRR9668926-trimmed-pair1.fastq, SRR9668926-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 17:04:58 2025 >> started Wed Feb 12 17:05:22 2025 >> done (24.204s) 31517325 read pairs processed; of these: 24 ( 0.00%) short read pairs filtered out after trimming by size control 3890 ( 0.01%) empty read pairs filtered out after trimming by size control 31513411 (99.99%) read pairs available; of these: 5721 ( 0.02%) trimmed read pairs available after processing 31507690 (99.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 4 0.00% 21 4 0.00% 22 5 0.00% 23 11 0.00% 24 9 0.00% 25 20 0.00% 26 21 0.00% 27 28 0.00% 28 26 0.00% 29 45 0.00% 30 33 0.00% 31 38 0.00% 32 35 0.00% 33 39 0.00% 34 48 0.00% 35 151 0.00% 36 164 0.00% 37 183 0.00% 38 162 0.00% 39 189 0.00% 40 223 0.00% 41 196 0.00% 42 252 0.00% 43 242 0.00% 44 298 0.00% 45 260 0.00% 46 244 0.00% 47 263 0.00% 48 313 0.00% 49 370 0.00% 50 452 0.00% 51 549 0.00% 52 502 0.00% 53 496 0.00% 54 521 0.00% 55 895 0.00% 56 925 0.00% 57 878 0.00% 58 939 0.00% 59 1010 0.00% 60 1060 0.00% 61 1033 0.00% 62 1206 0.00% 63 1322 0.00% 64 1416 0.00% 65 1614 0.01% 66 1677 0.01% 67 1907 0.01% 68 1940 0.01% 69 2259 0.01% 70 3329 0.01% 71 4924 0.02% 72 21770 0.07% 73 279912 0.89% 74 2631674 8.35% 75 15333795 48.66% 76 13211529 41.92% 31513411 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=1.76 fanout-score-rank=40 prefix-density=0.51 prefix-fanout=1.0 sequence=TAGTACCCTGGGGACTGGTGGTGCTCGCGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTGTTGCGAAGAAGGTACTCAATTTCCTGGGCCAATTGCTCAGTAGTGAGATCTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=40 fanout-score=58.10 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=8.9 sequence=TGCTGCTGCTGCATTTATTAGAGAAGGAGATGCTGGTAATCTCCATTTCACAAGTTCATTAATCTCGATCGAAAATATGGCTCATTTAAGCATATACAAAGTACATCTGGGAAAGAAAGTTAAGAACCAAGATAGGGTCACTGATATTTGGATGATGTTCATACGGAGAGGGAGGGAGAAAGGCTGTACTCAAGCCCCCAGAGCTCAAAACTGCCTTTGACAAAATCATAATAACCACCCTTCAGTCCTAGAGTTTTGTTCACCAAGCCATCTCTCACAAACGGGTAGGTTAGCAAGTGTCCAAGGGACACGTTCACTGCCTCCTTTTCACATTGTGTACAGAGGTCTGGGAAAGGTGCATTGGCATGTTCTGCTAAAACCTTAGTCTTGGCAGGGTAGCAAACTTTGACCCAGTCTTCTATGAAATCAGTTGATGTTGTTCCATCA criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=34 prefix-density=0.34 prefix-fanout=2.0 sequence=GAGTTCAATGCATGCAGGTGTGGCCTCCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACTACTGAGCAATTGGCCCAGGAAATTGAGTACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTGAGCTCGAGGAGGCGAAGAAAGCTTACCCTAACTCCTTTATCCGTATCATTGGATTCGACAACACTCGTCAAGTGCAGTGCATCAGTTTTATCGCCTCCAAGCCGAAGGGTGTCTAGGTTCCAAGATTTGATGAGTCCCTAGCTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=11.39 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=2.6 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR9668926 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 17:05:52 Started mapping on | Feb 12 17:05:53 Finished on | Feb 12 17:07:20 Mapping speed, Million of reads per hour | 1304.00 Number of input reads | 31513411 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 28400520 Uniquely mapped reads % | 90.12% Average mapped length | 150.45 Number of splices: Total | 12893551 Number of splices: Annotated (sjdb) | 12750625 Number of splices: GT/AG | 12666582 Number of splices: GC/AG | 193264 Number of splices: AT/AC | 8451 Number of splices: Non-canonical | 25254 Mismatch rate per base, % | 0.46% Deletion rate per base | 0.02% Deletion average length | 2.19 Insertion rate per base | 0.01% Insertion average length | 1.90 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1236248 % of reads mapped to multiple loci | 3.92% Number of reads mapped to too many loci | 781293 % of reads mapped to too many loci | 2.48% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.36% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1876680 1876680 1876680 N_multimapping 1236248 1236248 1236248 N_noFeature 622115 28082105 712180 N_ambiguous 387419 1201 158163 UnstrandedReadsAssigned:27390986 PositiveStrandReadsAssigned:317214 NegativeStrandReadsAssigned:27530177 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR9668926 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR9668926-trimmed-pair1.fastq SRR9668926-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,513,411 reads, 28,800,791 reads pseudoaligned [quant] estimated average fragment length: 205.784 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,180 rounds 52401 SRR9668926.ke.tsv 34699 SRR9668926.se.tsv 87100 total ==> SRR9668926.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1813.22 546 8.81218 Potri.005G024800.1.v4.1 1035 830.216 112 3.94791 Potri.004G059700.1.v4.1 961 756.216 78 3.01848 Potri.007G009000.2.v4.1 1416 1211.22 0 0 Potri.003G141000.2.v4.1 2943 2738.22 481.229 5.14309 Potri.016G087400.1.v4.1 270 86.2444 2273 771.275 Potri.015G069301.1.v4.1 564 359.547 0 0 Potri.010G195200.1.v4.1 1773 1568.22 9 0.167949 Potri.012G127500.1.v4.1 977 772.216 7517 284.87 ==> SRR9668926.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 43 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 472 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 114 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 14 SRR9668926 completed mapping pipeline successfully