Starting /dee2/code/volunteer_pipeline.sh SRR9668927 current disk space = 3051919798272 free memory = 1464386756 SRR9668927 SRAfilesize e4da7a9b5f272f1c531f48b3d95b6a6d SRR9668927.sra SRR9668927.sra file validated SRR9668927 is paired end SRR9668927 is conventional basespace SRR9668927 read1 length is 46-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668927_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 46-76 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.4285 32.0 32.0 32.0 32.0 32.0 2 31.5335 32.0 32.0 32.0 32.0 32.0 3 31.50375 32.0 32.0 32.0 32.0 32.0 4 31.511 32.0 32.0 32.0 32.0 32.0 5 31.579 32.0 32.0 32.0 32.0 32.0 6 34.83925 36.0 36.0 36.0 36.0 36.0 7 35.2345 36.0 36.0 36.0 36.0 36.0 8 35.153 36.0 36.0 36.0 36.0 36.0 9 35.20525 36.0 36.0 36.0 36.0 36.0 10-11 35.1535 36.0 36.0 36.0 36.0 36.0 12-13 35.151250000000005 36.0 36.0 36.0 36.0 36.0 14-15 35.06175 36.0 36.0 36.0 36.0 36.0 16-17 35.099375 36.0 36.0 36.0 36.0 36.0 18-19 35.07825 36.0 36.0 36.0 36.0 36.0 20-21 35.011625 36.0 36.0 36.0 36.0 36.0 22-23 35.012125 36.0 36.0 36.0 36.0 36.0 24-25 34.960375 36.0 36.0 36.0 36.0 36.0 26-27 35.033 36.0 36.0 36.0 36.0 36.0 28-29 34.888625000000005 36.0 36.0 36.0 32.0 36.0 30-31 34.91975 36.0 36.0 36.0 36.0 36.0 32-33 34.796375 36.0 36.0 36.0 34.0 36.0 34-35 34.854375 36.0 36.0 36.0 34.0 36.0 36-37 34.810249999999996 36.0 36.0 36.0 34.0 36.0 38-39 34.843625 36.0 36.0 36.0 36.0 36.0 40-41 34.781375 36.0 36.0 36.0 36.0 36.0 42-43 34.74275 36.0 36.0 36.0 34.0 36.0 44-45 34.723124999999996 36.0 36.0 36.0 34.0 36.0 46-47 34.76459877469367 36.0 36.0 36.0 32.0 36.0 48-49 34.84308577144286 36.0 36.0 36.0 36.0 36.0 50-51 34.78944736184046 36.0 36.0 36.0 34.0 36.0 52-53 34.68392098024506 36.0 36.0 36.0 32.0 36.0 54-55 34.61427856964241 36.0 36.0 36.0 32.0 36.0 56-57 34.55083474470419 36.0 36.0 36.0 32.0 36.0 58-59 34.63594297148575 36.0 36.0 36.0 32.0 36.0 60-61 34.51138069034518 36.0 36.0 36.0 32.0 36.0 62-63 34.410080040020006 36.0 36.0 36.0 32.0 36.0 64-65 34.381035776832626 36.0 36.0 36.0 32.0 36.0 66-67 34.308106079559664 36.0 36.0 36.0 32.0 36.0 68-69 34.3108581436077 36.0 36.0 36.0 32.0 36.0 70-71 34.195790862165644 36.0 36.0 36.0 32.0 36.0 72-73 34.32093367799898 36.0 36.0 36.0 32.0 36.0 74-75 34.19496125012307 36.0 36.0 36.0 32.0 36.0 76 33.37163720215219 36.0 32.0 36.0 27.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 2.0 23 4.0 24 8.0 25 13.0 26 17.0 27 31.0 28 60.0 29 69.0 30 100.0 31 120.0 32 138.0 33 253.0 34 567.0 35 2617.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.2 12.35 9.775 39.675 2 20.45 17.0 37.65 24.9 3 18.0 20.825 25.924999999999997 35.25 4 22.1 29.625 22.5 25.775 5 21.4 34.050000000000004 24.575 19.975 6 19.217171717171716 34.494949494949495 25.050505050505052 21.237373737373737 7 14.6 24.275 43.675000000000004 17.45 8 18.35 22.55 31.825 27.275 9 18.5 23.175 33.825 24.5 10-11 21.6875 32.074999999999996 23.875 22.3625 12-13 20.599999999999998 25.25 28.125 26.025 14-15 20.1 27.037499999999998 28.1 24.762500000000003 16-17 20.9 27.750000000000004 27.474999999999998 23.875 18-19 20.200000000000003 28.6875 26.450000000000003 24.6625 20-21 21.25 26.974999999999998 27.6875 24.087500000000002 22-23 21.2375 27.950000000000003 26.637499999999996 24.175 24-25 20.665083135391924 27.19089886235779 27.728466058257283 24.415551943992998 26-27 20.674999999999997 28.3375 27.037499999999998 23.95 28-29 20.9375 28.475 26.5375 24.05 30-31 20.200000000000003 29.012500000000003 26.674999999999997 24.1125 32-33 21.025 27.1375 27.900000000000002 23.9375 34-35 20.575 28.15 26.387500000000003 24.887500000000003 36-37 20.7875 28.5625 25.5625 25.087500000000002 38-39 21.0 27.200000000000003 26.174999999999997 25.624999999999996 40-41 21.637500000000003 28.275 26.4625 23.625 42-43 20.962500000000002 28.775000000000002 26.8 23.4625 44-45 21.5625 27.3125 27.462500000000002 23.6625 46-47 21.402675334416802 27.715964495561945 27.390923865483185 23.49043630453807 48-49 21.092773193298324 27.394348587146787 26.85671417854464 24.656164041010253 50-51 20.730182545636406 26.806701675418854 28.207051762940733 24.256064016004 52-53 21.492873218304574 28.744686171542888 26.694173543385848 23.068267066766694 54-55 20.530132533133283 28.33208302075519 26.469117279319832 24.668667166791696 56-57 20.495185694635488 26.997624109040892 27.235213204951858 25.271976991371766 58-59 20.210105052526263 27.876438219109556 27.301150575287643 24.61230615307654 60-61 21.87343671835918 27.40120060030015 26.88844422211106 23.836918459229615 62-63 21.748374187093546 27.37618809404702 27.051025512756375 23.82441220610305 64-65 21.403552664498374 27.970978233675257 27.220415311483613 23.405053790342755 66-67 21.053289967475607 27.370527895921942 26.832624468351263 24.74355766825119 68-69 20.627970978233677 27.295471603702776 27.257943457593193 24.818613960470355 70-71 20.63055173276617 27.236331790316527 27.17377705492306 24.959339421994244 72-73 21.168341708542712 26.821608040201006 27.550251256281406 24.459798994974875 74-75 21.243042671614102 24.595812350914393 28.240127219719056 25.921017757752452 76 21.252882398155265 0.0 39.39277478862414 39.3543428132206 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 1.5 23 5.0 24 6.0 25 3.5 26 7.5 27 14.0 28 19.0 29 24.0 30 28.5 31 37.0 32 52.0 33 61.0 34 70.0 35 95.5 36 121.0 37 132.0 38 153.0 39 193.0 40 229.0 41 258.0 42 269.5 43 257.5 44 271.5 45 301.0 46 301.5 47 301.5 48 291.0 49 258.5 50 231.5 51 210.0 52 189.5 53 164.5 54 146.0 55 124.0 56 108.5 57 85.5 58 57.5 59 55.5 60 47.0 61 31.0 62 23.0 63 20.5 64 10.5 65 3.0 66 2.5 67 3.0 68 5.0 69 3.5 70 1.5 71 1.5 72 1.5 73 3.0 74 4.0 75 3.5 76 1.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 1.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0125 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 46 1.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 1.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 1.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 1.0 71 5.0 72 22.0 73 69.0 74 254.0 75 1044.0 76 2602.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.3 #Duplication Level Percentage of deduplicated Percentage of total 1 98.42319430315362 96.75 2 1.449643947100712 2.85 3 0.10172939979654119 0.3 4 0.025432349949135298 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR9668927 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668927_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.0955 32.0 32.0 32.0 32.0 32.0 2 30.833 32.0 32.0 32.0 32.0 32.0 3 30.847 32.0 32.0 32.0 32.0 32.0 4 30.946 32.0 32.0 32.0 32.0 32.0 5 30.95175 32.0 32.0 32.0 32.0 32.0 6 34.27275 36.0 36.0 36.0 32.0 36.0 7 34.43975 36.0 36.0 36.0 32.0 36.0 8 34.29375 36.0 36.0 36.0 32.0 36.0 9 34.53925 36.0 36.0 36.0 32.0 36.0 10-11 34.211749999999995 36.0 36.0 36.0 32.0 36.0 12-13 34.319874999999996 36.0 36.0 36.0 32.0 36.0 14-15 34.211625 36.0 36.0 36.0 32.0 36.0 16-17 34.1635 36.0 36.0 36.0 32.0 36.0 18-19 34.229 36.0 36.0 36.0 32.0 36.0 20-21 34.0775 36.0 36.0 36.0 32.0 36.0 22-23 34.105500000000006 36.0 36.0 36.0 32.0 36.0 24-25 34.13375 36.0 36.0 36.0 32.0 36.0 26-27 34.10125 36.0 36.0 36.0 32.0 36.0 28-29 34.059125 36.0 36.0 36.0 32.0 36.0 30-31 34.086875000000006 36.0 36.0 36.0 32.0 36.0 32-33 34.115625 36.0 36.0 36.0 32.0 36.0 34-35 33.962375 36.0 36.0 36.0 32.0 36.0 36-37 33.99637227920941 36.0 36.0 36.0 32.0 36.0 38-39 33.94796097072805 36.0 36.0 36.0 32.0 36.0 40-41 33.82324243182387 36.0 36.0 36.0 29.5 36.0 42-43 33.73680260195147 36.0 36.0 36.0 27.0 36.0 44-45 33.78617822225527 36.0 36.0 36.0 27.0 36.0 46-47 33.81806806806807 36.0 36.0 36.0 27.0 36.0 48-49 33.81081081081081 36.0 36.0 36.0 27.0 36.0 50-51 33.71746746746747 36.0 36.0 36.0 27.0 36.0 52-53 33.59572072072072 36.0 36.0 36.0 27.0 36.0 54-55 33.60885885885886 36.0 36.0 36.0 27.0 36.0 56-57 33.53885377868482 36.0 36.0 36.0 27.0 36.0 58-59 33.43153942428035 36.0 36.0 36.0 27.0 36.0 60-61 33.42991239048811 36.0 36.0 36.0 27.0 36.0 62-63 33.47434292866083 36.0 36.0 36.0 27.0 36.0 64-65 33.3829494241362 36.0 36.0 36.0 27.0 36.0 66-67 33.32648973460191 36.0 36.0 36.0 24.0 36.0 68-69 33.44829744616925 36.0 36.0 36.0 27.0 36.0 70-71 33.26940410615924 36.0 36.0 36.0 24.0 36.0 72-73 33.40345114090378 36.0 36.0 36.0 27.0 36.0 74-75 33.41191024183038 36.0 36.0 36.0 27.0 36.0 76 32.222049084534476 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 2.0 11 1.0 12 0.0 13 0.0 14 0.0 15 5.0 16 14.0 17 2.0 18 8.0 19 9.0 20 10.0 21 12.0 22 16.0 23 22.0 24 24.0 25 34.0 26 43.0 27 54.0 28 79.0 29 118.0 30 127.0 31 158.0 32 225.0 33 323.0 34 676.0 35 2035.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.669174818159014 22.22222222222222 12.992224730373714 28.116378229245047 2 28.592889334001004 27.1156735102654 30.345518277416122 13.945918878317476 3 21.290968226169625 28.521391043282463 28.49637227920941 21.691268451338505 4 24.69352014010508 34.72604453340005 21.19089316987741 19.389542156617463 5 25.719289467100324 37.052789592194145 21.4160620465349 15.811858894170626 6 21.66624968726545 37.80335251438579 21.165874405804352 19.36452339254441 7 21.115836877658246 18.739054290718038 38.95421566174631 21.19089316987741 8 23.092319239429575 22.992244183137352 26.670002501876404 27.24543407555667 9 23.617713284963724 24.31823867900926 29.071803852889666 22.992244183137352 10-11 25.193895421566175 31.185889417062796 22.679509632224168 20.94070552914686 12-13 25.481611208406306 25.606705028771582 25.719289467100324 23.19239429572179 14-15 24.486986986986985 28.153153153153156 27.027027027027028 20.332832832832835 16-17 25.30678687703481 26.872026045579766 26.508890558477333 21.312296518908088 18-19 24.193144858643983 28.246184638478862 26.319739804853644 21.240930698023515 20-21 24.780976220275345 27.40926157697122 25.982478097622025 21.827284105131415 22-23 25.181567743551213 27.335336839469072 25.957926371149508 21.525169045830204 24-25 24.405506883604506 26.87108886107635 26.69586983729662 22.02753441802253 26-27 24.280710532899676 28.33375031273455 25.74430823117338 21.641230923192396 28-29 24.89044697633655 27.657443345436334 26.180042569174912 21.27206710905221 30-31 24.142248935637365 27.335336839469072 27.07237665915352 21.450037565740047 32-33 24.455296769346358 27.585775106436262 26.37114951164538 21.587778612572002 34-35 25.093914350112694 27.473077886301027 25.757575757575758 21.675432006010517 36-37 24.354798296166376 27.374091706339264 27.23628163367577 21.03482836381859 38-39 24.47035226275542 28.130876269274165 26.062429484768714 21.336341983201702 40-41 25.184999372883482 27.204314561645553 26.238555123541957 21.37213094192901 42-43 24.460341365461847 27.058232931726906 26.92018072289157 21.561244979919678 44-45 25.806856712294362 26.47243501193018 26.284063795052116 21.436644480723345 46-47 25.232237007280943 27.717800652774287 25.784584484057245 21.26537785588752 48-49 24.68037102030584 28.365505139132612 25.670594133868136 21.283529706693407 50-51 25.379120190500064 26.845469357062292 26.69507457074821 21.080335881689436 52-53 25.6362040867494 26.776983828506957 26.739375705152312 20.847436379591326 54-55 25.11913719588663 26.73689490845247 26.86230248306998 21.281665412590918 56-57 24.2218875502008 27.547690763052206 26.19226907630522 22.038152610441767 58-59 25.09100037655328 26.772938370779464 27.940253545876743 20.19580770679051 60-61 25.078330617871913 26.88306805364081 26.456949492417596 21.581651836069682 62-63 25.144218710810133 26.824680210684726 27.037873087534486 20.993227990970656 64-65 24.62986198243413 26.67503136762861 26.96361355081556 21.731493099121707 66-67 24.38504016064257 27.497489959839356 26.15461847389558 21.96285140562249 68-69 26.100589489527152 26.32635143609683 26.75279066850621 20.82026840586981 70-71 25.513784461152884 26.954887218045116 26.42857142857143 21.102756892230577 72-73 25.43782285498299 26.798538490613584 26.092982235101424 21.670656419302002 74-75 25.78009910271863 23.449845989018346 28.699611624481047 22.070443283781973 76 27.223088923556944 0.0 39.39157566302652 33.38533541341654 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3.0 1 1.5 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 1.0 9 0.5 10 0.5 11 1.0 12 1.0 13 0.5 14 1.0 15 1.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 3.5 23 4.5 24 2.0 25 1.5 26 2.5 27 6.0 28 10.5 29 13.0 30 20.0 31 25.0 32 32.0 33 41.0 34 51.0 35 79.0 36 101.0 37 111.0 38 142.0 39 192.5 40 217.0 41 243.0 42 277.5 43 309.5 44 327.0 45 315.5 46 308.0 47 293.5 48 279.0 49 275.5 50 270.0 51 231.0 52 184.5 53 155.5 54 137.0 55 110.5 56 87.0 57 77.0 58 68.0 59 58.0 60 51.0 61 42.0 62 27.0 63 20.5 64 11.5 65 5.5 66 4.5 67 4.0 68 5.0 69 4.5 70 2.5 71 3.5 72 5.0 73 4.0 74 1.0 75 0.0 76 0.0 77 1.0 78 1.5 79 1.0 80 0.5 81 0.0 82 0.5 83 1.0 84 1.0 85 0.5 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.5 92 1.0 93 1.0 94 0.5 95 1.0 96 2.0 97 2.0 98 2.5 99 13.0 100 23.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.15 3 0.075 4 0.075 5 0.075 6 0.075 7 0.075 8 0.075 9 0.075 10-11 0.075 12-13 0.075 14-15 0.1 16-17 0.17500000000000002 18-19 0.075 20-21 0.125 22-23 0.17500000000000002 24-25 0.125 26-27 0.075 28-29 0.1625 30-31 0.17500000000000002 32-33 0.17500000000000002 34-35 0.17500000000000002 36-37 0.15011258443832876 38-39 0.21265949462096573 40-41 0.2626970227670753 42-43 0.32524393294971227 44-45 0.3753284123608157 46-47 0.3253253253253253 48-49 0.17517517517517517 50-51 0.16266266266266266 52-53 0.18768768768768768 54-55 0.22522522522522523 56-57 0.2878238017769991 58-59 0.2878598247809762 60-61 0.1376720901126408 62-63 0.2002503128911139 64-65 0.2253380070105158 66-67 0.25037556334501754 68-69 0.18778167250876315 70-71 0.10015022533800699 72-73 0.16352201257861634 74-75 0.08028904054596547 76 0.11686793922867161 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 3.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 1.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 1.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 1.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 6.0 72 26.0 73 95.0 74 261.0 75 1039.0 76 2567.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.25 #Duplication Level Percentage of deduplicated Percentage of total 1 98.9821882951654 97.25 2 0.8396946564885497 1.6500000000000001 3 0.10178117048346055 0.3 4 0.05089058524173028 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02544529262086514 0.6 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 24 0.6 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1548198 spots for SRR9668927.sra Written 1548198 spots for SRR9668927.sra Read 1548198 spots for SRR9668927.sra Written 1548198 spots for SRR9668927.sra Read 1548198 spots for SRR9668927.sra Written 1548198 spots for SRR9668927.sra Read 1548198 spots for SRR9668927.sra Written 1548198 spots for SRR9668927.sra Read 1548198 spots for SRR9668927.sra Written 1548198 spots for SRR9668927.sra Read 1548198 spots for SRR9668927.sra Written 1548198 spots for SRR9668927.sra Read 1548198 spots for SRR9668927.sra Written 1548198 spots for SRR9668927.sra Read 1548200 spots for SRR9668927.sra Written 1548200 spots for SRR9668927.sra Read 1548198 spots for SRR9668927.sra Written 1548198 spots for SRR9668927.sra Read 1548198 spots for SRR9668927.sra Written 1548198 spots for SRR9668927.sra Read 1548198 spots for SRR9668927.sra Written 1548198 spots for SRR9668927.sra Read 1548198 spots for SRR9668927.sra Written 1548198 spots for SRR9668927.sra Read 1548198 spots for SRR9668927.sra Written 1548198 spots for SRR9668927.sra Read 1548198 spots for SRR9668927.sra Written 1548198 spots for SRR9668927.sra Read 1548198 spots for SRR9668927.sra Written 1548198 spots for SRR9668927.sra Read 1548198 spots for SRR9668927.sra Written 1548198 spots for SRR9668927.sra Read 1548198 spots for SRR9668927.sra Written 1548198 spots for SRR9668927.sra Read 1548198 spots for SRR9668927.sra Written 1548198 spots for SRR9668927.sra Read 1548198 spots for SRR9668927.sra Written 1548198 spots for SRR9668927.sra Read 1548198 spots for SRR9668927.sra Written 1548198 spots for SRR9668927.sra SRR ids: ['SRR9668927.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ta6_tj54 SRR9668927.sra spots: 30963962 blocks: [[1, 1548198], [1548199, 3096396], [3096397, 4644594], [4644595, 6192792], [6192793, 7740990], [7740991, 9289188], [9289189, 10837386], [10837387, 12385584], [12385585, 13933782], [13933783, 15481980], [15481981, 17030178], [17030179, 18578376], [18578377, 20126574], [20126575, 21674772], [21674773, 23222970], [23222971, 24771168], [24771169, 26319366], [26319367, 27867564], [27867565, 29415762], [29415763, 30963962]] SRR9668927 file size 5875232 SRR9668927 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR9668927 SRR9668927_1.fastq SRR9668927_2.fastq Input file: SRR9668927_1.fastq Paired file: SRR9668927_2.fastq trimmed: SRR9668927-trimmed-pair1.fastq, SRR9668927-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 17:03:33 2025 >> started Wed Feb 12 17:04:16 2025 >> done (42.968s) 30963962 read pairs processed; of these: 19 ( 0.00%) short read pairs filtered out after trimming by size control 4612 ( 0.01%) empty read pairs filtered out after trimming by size control 30959331 (99.99%) read pairs available; of these: 5354 ( 0.02%) trimmed read pairs available after processing 30953977 (99.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 1 0.00% 21 2 0.00% 22 5 0.00% 23 7 0.00% 24 5 0.00% 25 8 0.00% 26 13 0.00% 27 11 0.00% 28 18 0.00% 29 23 0.00% 30 11 0.00% 31 18 0.00% 32 24 0.00% 33 15 0.00% 34 25 0.00% 35 123 0.00% 36 151 0.00% 37 152 0.00% 38 172 0.00% 39 157 0.00% 40 190 0.00% 41 207 0.00% 42 248 0.00% 43 240 0.00% 44 310 0.00% 45 315 0.00% 46 267 0.00% 47 364 0.00% 48 403 0.00% 49 470 0.00% 50 550 0.00% 51 668 0.00% 52 645 0.00% 53 626 0.00% 54 734 0.00% 55 1045 0.00% 56 1178 0.00% 57 1135 0.00% 58 1165 0.00% 59 1415 0.00% 60 1529 0.00% 61 1488 0.00% 62 1719 0.01% 63 1887 0.01% 64 2019 0.01% 65 2197 0.01% 66 2402 0.01% 67 2645 0.01% 68 2828 0.01% 69 3171 0.01% 70 4159 0.01% 71 6122 0.02% 72 22197 0.07% 73 268131 0.87% 74 2549305 8.23% 75 14980022 48.39% 76 13094392 42.30% 30959331 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=25 prefix-density=0.53 prefix-fanout=2.1 sequence=CTGATGCACTGCACTTGACGAGTGTTGTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGG criterion=fanout-score sequence-density=0.05 sequence-density-rank=29 fanout-score=12.13 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=3.2 sequence=TTTGGCTTGTAGATTGG criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=31 prefix-density=0.31 prefix-fanout=2.0 sequence=GAGTTCAATGCATGCAGGTGTGGCCTCCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACTACTGAGCAATTGGCCCAGGAAATTGAGTACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTGAGCTCGAGGAGGCGAAGAAAGCTTACCCTAACTCCTTTATCCGTATCATTGGATTCGACAACACTCGTCAAGTGCAGTGCATCAGTTTTATCGCCTCCAAGCCGAAGGGTGTCTAGGTTCCAAGATTTGATGAGTCCCTAGCTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=20.02 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=4.7 sequence=AGGAAAGGCTTACGGTGGATACCTAGGCACCCAGAGACGAGGAAGGGCGTAGTAAGCGACGAAATGCTTCGGGGAGTTGAAAATAAGCGTAGATCCGGAGATTCCCGAATAGGTCAACCTTTCAAACTGCTGCCGAATCCATGGGCAGGCAAGAGACAACCTGGCGAACTGAAACATCTTAGTAACCAGAGGAAAAGAA SRR9668927 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 17:04:42 Started mapping on | Feb 12 17:04:43 Finished on | Feb 12 17:07:59 Mapping speed, Million of reads per hour | 568.64 Number of input reads | 30959331 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 26796315 Uniquely mapped reads % | 86.55% Average mapped length | 150.40 Number of splices: Total | 11952367 Number of splices: Annotated (sjdb) | 11815304 Number of splices: GT/AG | 11741156 Number of splices: GC/AG | 179316 Number of splices: AT/AC | 8013 Number of splices: Non-canonical | 23882 Mismatch rate per base, % | 0.50% Deletion rate per base | 0.02% Deletion average length | 2.19 Insertion rate per base | 0.01% Insertion average length | 1.95 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1290608 % of reads mapped to multiple loci | 4.17% Number of reads mapped to too many loci | 1587555 % of reads mapped to too many loci | 5.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.89% % of reads unmapped: other | 0.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2872456 2872456 2872456 N_multimapping 1290608 1290608 1290608 N_noFeature 826028 26454510 919257 N_ambiguous 400240 1342 150636 UnstrandedReadsAssigned:25570047 PositiveStrandReadsAssigned:340463 NegativeStrandReadsAssigned:25726422 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR9668927 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR9668927-trimmed-pair1.fastq SRR9668927-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,959,331 reads, 27,572,040 reads pseudoaligned [quant] estimated average fragment length: 205.404 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,022 rounds 52401 SRR9668927.ke.tsv 34699 SRR9668927.se.tsv 87100 total ==> SRR9668927.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1813.6 477 7.78911 Potri.005G024800.1.v4.1 1035 830.596 105 3.74377 Potri.004G059700.1.v4.1 961 756.602 49 1.91796 Potri.007G009000.2.v4.1 1416 1211.6 0 0 Potri.003G141000.2.v4.1 2943 2738.6 413.304 4.46943 Potri.016G087400.1.v4.1 270 86.6522 1973.36 674.43 Potri.015G069301.1.v4.1 564 359.843 0 0 Potri.010G195200.1.v4.1 1773 1568.6 10 0.188799 Potri.012G127500.1.v4.1 977 772.596 6312 241.949 ==> SRR9668927.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 26 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 432 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 123 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 12 SRR9668927 completed mapping pipeline successfully