Starting /dee2/code/volunteer_pipeline.sh SRR9668928 current disk space = 3051623415808 free memory = 1578522644 SRR9668928 SRAfilesize eb268c4d8c152f42a42b3bb9a9f367b8 SRR9668928.sra SRR9668928.sra file validated SRR9668928 is paired end SRR9668928 is conventional basespace SRR9668928 read1 length is 61-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668928_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 61-76 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.485 32.0 32.0 32.0 32.0 32.0 2 31.498 32.0 32.0 32.0 32.0 32.0 3 31.5905 32.0 32.0 32.0 32.0 32.0 4 31.583 32.0 32.0 32.0 32.0 32.0 5 31.654 32.0 32.0 32.0 32.0 32.0 6 34.6495 36.0 36.0 36.0 36.0 36.0 7 35.17175 36.0 36.0 36.0 36.0 36.0 8 35.10825 36.0 36.0 36.0 36.0 36.0 9 35.10775 36.0 36.0 36.0 36.0 36.0 10-11 35.170375 36.0 36.0 36.0 36.0 36.0 12-13 35.1205 36.0 36.0 36.0 36.0 36.0 14-15 35.10775 36.0 36.0 36.0 36.0 36.0 16-17 35.11175 36.0 36.0 36.0 36.0 36.0 18-19 35.23725 36.0 36.0 36.0 36.0 36.0 20-21 35.10724999999999 36.0 36.0 36.0 36.0 36.0 22-23 35.039500000000004 36.0 36.0 36.0 36.0 36.0 24-25 35.065250000000006 36.0 36.0 36.0 36.0 36.0 26-27 34.997375000000005 36.0 36.0 36.0 36.0 36.0 28-29 35.055125000000004 36.0 36.0 36.0 36.0 36.0 30-31 35.018249999999995 36.0 36.0 36.0 36.0 36.0 32-33 34.882999999999996 36.0 36.0 36.0 36.0 36.0 34-35 34.886250000000004 36.0 36.0 36.0 36.0 36.0 36-37 34.830625 36.0 36.0 36.0 36.0 36.0 38-39 34.92425 36.0 36.0 36.0 36.0 36.0 40-41 34.837875 36.0 36.0 36.0 36.0 36.0 42-43 34.829750000000004 36.0 36.0 36.0 36.0 36.0 44-45 34.752250000000004 36.0 36.0 36.0 36.0 36.0 46-47 34.872749999999996 36.0 36.0 36.0 36.0 36.0 48-49 34.839625 36.0 36.0 36.0 36.0 36.0 50-51 34.73425 36.0 36.0 36.0 36.0 36.0 52-53 34.646625 36.0 36.0 36.0 32.0 36.0 54-55 34.637375 36.0 36.0 36.0 32.0 36.0 56-57 34.598375 36.0 36.0 36.0 32.0 36.0 58-59 34.746624999999995 36.0 36.0 36.0 32.0 36.0 60-61 34.5855 36.0 36.0 36.0 32.0 36.0 62-63 34.46135567783892 36.0 36.0 36.0 32.0 36.0 64-65 34.41458229114557 36.0 36.0 36.0 32.0 36.0 66-67 34.375843538481774 36.0 36.0 36.0 32.0 36.0 68-69 34.34475856892669 36.0 36.0 36.0 32.0 36.0 70-71 34.3697431083325 36.0 36.0 36.0 32.0 36.0 72-73 34.315804307573075 36.0 36.0 36.0 32.0 36.0 74-75 34.336096544661615 36.0 36.0 36.0 32.0 36.0 76 33.38637214526395 36.0 32.0 36.0 27.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 2.0 24 5.0 25 6.0 26 24.0 27 26.0 28 57.0 29 72.0 30 89.0 31 112.0 32 165.0 33 230.0 34 553.0 35 2657.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.725 12.6 10.549999999999999 43.125 2 20.974999999999998 16.125 38.525 24.375 3 18.925 19.85 25.374999999999996 35.85 4 21.85 30.475 22.375 25.3 5 21.125 35.025 23.724999999999998 20.125 6 19.507864028411973 33.71385083713851 25.240994419076614 21.537290715372905 7 14.875 22.575 43.824999999999996 18.725 8 18.75 21.7 33.25 26.3 9 18.75 21.4 32.625 27.224999999999998 10-11 21.475 31.7125 23.275000000000002 23.5375 12-13 20.7375 24.8 28.525 25.937500000000004 14-15 21.2625 26.200000000000003 27.787499999999998 24.75 16-17 21.15 27.0 27.200000000000003 24.65 18-19 20.925 28.175 26.1 24.8 20-21 21.4875 26.5875 27.3625 24.5625 22-23 21.212500000000002 26.787499999999998 27.5625 24.4375 24-25 20.8125 26.887499999999996 27.3125 24.9875 26-27 21.55 26.9625 26.325 25.162499999999998 28-29 20.9125 27.750000000000004 26.637499999999996 24.7 30-31 21.125 26.8 27.450000000000003 24.625 32-33 21.6125 26.937499999999996 27.5125 23.9375 34-35 21.1125 27.075 26.8375 24.975 36-37 20.575 28.275 25.974999999999998 25.174999999999997 38-39 22.025 26.5875 25.95 25.4375 40-41 21.55 27.3875 26.5 24.5625 42-43 20.4875 26.7625 27.175 25.575 44-45 20.7125 26.075 27.85 25.362499999999997 46-47 21.0375 27.3875 27.175 24.4 48-49 20.4375 27.6 26.737499999999997 25.224999999999998 50-51 20.8 26.625 27.237499999999997 25.337500000000002 52-53 20.474999999999998 27.037499999999998 27.05 25.4375 54-55 20.6125 27.474999999999998 26.724999999999998 25.1875 56-57 19.9625 27.425 27.650000000000002 24.962500000000002 58-59 20.9125 27.037499999999998 27.2625 24.7875 60-61 20.7 26.8625 26.3625 26.075 62-63 21.310655327663834 26.513256628314156 26.825912956478238 25.350175087543768 64-65 20.610305152576288 27.55127563781891 26.850925462731368 24.987493746873437 66-67 21.100687929956223 27.21701063164478 26.6541588492808 25.028142589118197 68-69 21.053289967475607 26.99524643482612 27.62071553665249 24.330748061045785 70-71 20.12012012012012 27.75275275275275 27.565065065065063 24.56206206206206 72-73 20.95274007038713 27.828054298642535 26.35746606334842 24.86173956762192 74-75 21.746031746031747 23.49206349206349 28.08201058201058 26.67989417989418 76 22.463496817671285 0.0 39.34855859228753 38.187944590041184 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.5 24 3.5 25 5.5 26 5.5 27 13.5 28 23.5 29 24.0 30 25.0 31 33.0 32 49.0 33 62.0 34 66.5 35 76.5 36 97.5 37 119.5 38 135.0 39 162.5 40 198.5 41 229.5 42 249.0 43 275.5 44 300.0 45 291.5 46 282.5 47 292.0 48 297.0 49 263.5 50 222.0 51 215.0 52 195.0 53 163.0 54 152.5 55 135.0 56 120.0 57 109.0 58 95.0 59 87.5 60 69.0 61 37.5 62 20.5 63 19.0 64 13.5 65 11.0 66 9.0 67 5.5 68 6.5 69 5.0 70 2.0 71 1.5 72 3.0 73 3.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 1.4500000000000002 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 61 2.0 62 0.0 63 0.0 64 0.0 65 0.0 66 1.0 67 0.0 68 0.0 69 0.0 70 2.0 71 6.0 72 22.0 73 61.0 74 252.0 75 983.0 76 2671.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.15 #Duplication Level Percentage of deduplicated Percentage of total 1 97.47812660833762 94.69999999999999 2 2.1873391662377766 4.25 3 0.28306742151312403 0.8250000000000001 4 0.02573340195573855 0.1 5 0.02573340195573855 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGAGTTATCATGAATCATCAGAGCAACGGGCAGAGCCCGCGTCGACCTTTTATCTAATAAATGCGTCCCTTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR9668928 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668928_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.08575 32.0 32.0 32.0 32.0 32.0 2 31.0365 32.0 32.0 32.0 32.0 32.0 3 30.9965 32.0 32.0 32.0 32.0 32.0 4 31.048 32.0 32.0 32.0 32.0 32.0 5 31.08575 32.0 32.0 32.0 32.0 32.0 6 34.36825 36.0 36.0 36.0 32.0 36.0 7 34.54225 36.0 36.0 36.0 32.0 36.0 8 34.4685 36.0 36.0 36.0 32.0 36.0 9 34.578 36.0 36.0 36.0 32.0 36.0 10-11 34.29675 36.0 36.0 36.0 32.0 36.0 12-13 34.404375 36.0 36.0 36.0 32.0 36.0 14-15 34.304375 36.0 36.0 36.0 32.0 36.0 16-17 34.30575 36.0 36.0 36.0 32.0 36.0 18-19 34.249125 36.0 36.0 36.0 32.0 36.0 20-21 34.297375 36.0 36.0 36.0 32.0 36.0 22-23 34.214375000000004 36.0 36.0 36.0 32.0 36.0 24-25 34.241625 36.0 36.0 36.0 32.0 36.0 26-27 34.23675 36.0 36.0 36.0 32.0 36.0 28-29 34.152625 36.0 36.0 36.0 32.0 36.0 30-31 34.211875000000006 36.0 36.0 36.0 32.0 36.0 32-33 34.141125 36.0 36.0 36.0 32.0 36.0 34-35 34.147875 36.0 36.0 36.0 32.0 36.0 36-37 34.11108331248436 36.0 36.0 36.0 32.0 36.0 38-39 34.013893647212385 36.0 36.0 36.0 32.0 36.0 40-41 33.90665665665666 36.0 36.0 36.0 32.0 36.0 42-43 33.85832290362954 36.0 36.0 36.0 32.0 36.0 44-45 33.91458232643599 36.0 36.0 36.0 32.0 36.0 46-47 33.79534068136273 36.0 36.0 36.0 27.0 36.0 48-49 34.072055137844615 36.0 36.0 36.0 32.0 36.0 50-51 33.927067669172935 36.0 36.0 36.0 29.5 36.0 52-53 33.81654135338346 36.0 36.0 36.0 29.5 36.0 54-55 33.78721804511278 36.0 36.0 36.0 29.5 36.0 56-57 33.67117794486215 36.0 36.0 36.0 29.5 36.0 58-59 33.711779448621556 36.0 36.0 36.0 27.0 36.0 60-61 33.58753919770597 36.0 36.0 36.0 27.0 36.0 62-63 33.66867318786055 36.0 36.0 36.0 27.0 36.0 64-65 33.423375971908705 36.0 36.0 36.0 27.0 36.0 66-67 33.556125710113314 36.0 36.0 36.0 27.0 36.0 68-69 33.5235825388861 36.0 36.0 36.0 27.0 36.0 70-71 33.5925148937215 36.0 36.0 36.0 27.0 36.0 72-73 33.388005581568486 36.0 36.0 36.0 27.0 36.0 74-75 33.50293710385743 36.0 36.0 36.0 27.0 36.0 76 32.46227499042512 36.0 32.0 36.0 21.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 1.0 15 8.0 16 15.0 17 8.0 18 4.0 19 7.0 20 4.0 21 12.0 22 15.0 23 12.0 24 19.0 25 32.0 26 47.0 27 61.0 28 75.0 29 91.0 30 115.0 31 142.0 32 216.0 33 308.0 34 673.0 35 2130.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.18546365914787 20.80200501253133 14.837092731829573 30.175438596491226 2 31.505133984472828 26.070623591284747 29.05083896819434 13.373403456048083 3 22.566925193895422 26.64498373780335 28.04603452589442 22.742056542406804 4 25.719289467100324 35.426569927445584 20.140105078809107 18.714035526644984 5 26.494871153365025 35.80185138854141 21.290968226169625 16.412309231923945 6 22.66700025018764 35.851888916687514 22.39179384538404 19.089316987740805 7 22.54190642982237 19.339504628471353 36.37728296222167 21.74130597948461 8 22.942206654991242 22.9672254190643 27.1703777833375 26.920190142606952 9 23.767825869402053 23.667750813109834 28.74655991993996 23.817863397548162 10-11 26.157117838378785 31.185889417062796 21.62872154115587 21.02827120340255 12-13 25.41906429822367 24.91868901676257 26.09457092819615 23.567675756817614 14-15 24.55591693770328 27.595696772579437 26.08206154615962 21.766324743557668 16-17 25.15959444235824 28.02603579922393 25.397421454499934 21.416948303917888 18-19 24.34325744308231 27.1703777833375 26.782586940205157 21.70377783337503 20-21 26.079339256663747 26.967838818671 25.60380427981479 21.349017644850456 22-23 25.25669922364137 26.35862759829702 26.120711244678184 22.26396193338342 24-25 24.95307220623201 27.49343010887248 26.004254786634963 21.54924289826054 26-27 24.893670252689517 27.295471603702776 26.257192894671004 21.553665248936703 28-29 24.50869946175992 28.17624233320816 26.03579922393291 21.279258981099012 30-31 25.870709095464793 26.8479077925332 26.171385617639693 21.109997494362315 32-33 24.674511767651477 27.94191286930396 25.913870806209317 21.469704556835254 34-35 24.583594239198497 27.56418284283031 26.48716343143394 21.36505948653726 36-37 25.529780564263323 27.912225705329153 26.043887147335422 20.5141065830721 38-39 24.47289156626506 27.535140562248994 25.665160642570285 22.326807228915662 40-41 25.94873083689369 27.93415431012817 24.868057300829356 21.24905755214878 42-43 24.0125786163522 27.031446540880506 27.308176100628927 21.647798742138367 44-45 24.329091596321028 27.403300995338288 26.59695098903868 21.670656419302002 46-47 25.67006417516044 28.08607021517554 25.191896313074114 21.05196929658991 48-49 25.0344914085037 27.154145240185628 25.93753919478239 21.873824156528283 50-51 24.993729621269125 27.06295460245799 26.71181339352897 21.231502382743916 52-53 25.329484122003265 26.120246014811094 26.333626208108445 22.216643655077192 54-55 24.96544792059304 27.239602965196635 26.699334087196885 21.095615027013444 56-57 25.393032322978243 26.751352031191043 25.694881147025534 22.160734498805184 58-59 25.462089777442475 26.820067898906075 26.88293725638124 20.834905067270213 60-61 24.658221497554244 27.86905807098959 26.11313181989214 21.35958861156403 62-63 24.855636454933467 26.901832789354756 26.36203866432337 21.8804920913884 64-65 24.890006285355124 27.894406033940918 26.184789440603396 21.030798240100566 66-67 24.635311871227366 26.65995975855131 26.496478873239436 22.208249496981892 68-69 24.469287777917348 27.031779927144832 26.68006531842733 21.81886697651049 70-71 25.298029865729703 27.468942150834486 25.699585895344462 21.533442088091352 72-73 25.022082018927446 27.381703470031542 25.66561514195584 21.930599369085176 74-75 25.840279645065877 23.299273998386663 27.507394460876576 23.35305189567088 76 27.958636537725013 0.0 40.061279203370354 31.980084258904633 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 3.0 1 1.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 1.0 10 0.5 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 1.0 18 2.0 19 2.5 20 2.5 21 1.5 22 1.5 23 2.5 24 2.0 25 1.5 26 4.5 27 8.0 28 10.5 29 12.0 30 15.0 31 22.0 32 38.0 33 50.0 34 56.5 35 76.5 36 105.5 37 122.0 38 157.5 39 184.5 40 198.0 41 233.0 42 244.5 43 269.0 44 302.0 45 313.5 46 310.5 47 297.0 48 293.5 49 262.0 50 219.5 51 206.0 52 182.5 53 145.0 54 126.5 55 122.0 56 114.0 57 101.0 58 89.5 59 74.5 60 60.0 61 52.5 62 43.0 63 28.0 64 12.5 65 12.0 66 11.5 67 7.0 68 10.5 69 11.0 70 6.5 71 5.0 72 6.0 73 5.0 74 1.5 75 0.5 76 1.5 77 1.0 78 0.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 1.0 87 1.0 88 0.5 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.5 96 1.0 97 1.0 98 0.5 99 10.5 100 21.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.17500000000000002 3 0.075 4 0.075 5 0.075 6 0.075 7 0.075 8 0.075 9 0.075 10-11 0.075 12-13 0.075 14-15 0.075 16-17 0.13749999999999998 18-19 0.075 20-21 0.11249999999999999 22-23 0.17500000000000002 24-25 0.11249999999999999 26-27 0.075 28-29 0.13749999999999998 30-31 0.22499999999999998 32-33 0.15 34-35 0.1875 36-37 0.2376782586940205 38-39 0.3127736769673464 40-41 0.42542542542542544 42-43 0.5006257822277848 44-45 0.6011271133375079 46-47 0.4634268537074149 48-49 0.08771929824561403 50-51 0.07518796992481204 52-53 0.16290726817042606 54-55 0.2631578947368421 56-57 0.3634085213032582 58-59 0.3383458646616541 60-61 0.07519739315703722 62-63 0.1003260596940055 64-65 0.2382743917732631 66-67 0.2633889376646181 68-69 0.13798294029101857 70-71 0.02509095471082675 72-73 0.06305170239596469 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 3.0 36 0.0 37 0.0 38 1.0 39 0.0 40 0.0 41 1.0 42 0.0 43 2.0 44 1.0 45 0.0 46 0.0 47 2.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 1.0 61 2.0 62 0.0 63 0.0 64 0.0 65 0.0 66 1.0 67 0.0 68 0.0 69 0.0 70 1.0 71 6.0 72 28.0 73 81.0 74 302.0 75 957.0 76 2611.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.15 #Duplication Level Percentage of deduplicated Percentage of total 1 97.8641276376737 95.075 2 1.827071538857437 3.55 3 0.28306742151312403 0.8250000000000001 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02573340195573855 0.5499999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 22 0.5499999999999999 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1871469 spots for SRR9668928.sra Written 1871469 spots for SRR9668928.sra Read 1871469 spots for SRR9668928.sra Written 1871469 spots for SRR9668928.sra Read 1871469 spots for SRR9668928.sra Written 1871469 spots for SRR9668928.sra Read 1871469 spots for SRR9668928.sra Written 1871469 spots for SRR9668928.sra Read 1871469 spots for SRR9668928.sra Written 1871469 spots for SRR9668928.sra Read 1871469 spots for SRR9668928.sra Written 1871469 spots for SRR9668928.sra Read 1871469 spots for SRR9668928.sra Written 1871469 spots for SRR9668928.sra Read 1871469 spots for SRR9668928.sra Written 1871469 spots for SRR9668928.sra Read 1871469 spots for SRR9668928.sra Written 1871469 spots for SRR9668928.sra Read 1871469 spots for SRR9668928.sra Written 1871469 spots for SRR9668928.sra Read 1871469 spots for SRR9668928.sra Written 1871469 spots for SRR9668928.sra Read 1871469 spots for SRR9668928.sra Written 1871469 spots for SRR9668928.sra Read 1871469 spots for SRR9668928.sra Written 1871469 spots for SRR9668928.sra Read 1871469 spots for SRR9668928.sra Written 1871469 spots for SRR9668928.sra Read 1871469 spots for SRR9668928.sra Written 1871469 spots for SRR9668928.sra Read 1871469 spots for SRR9668928.sra Written 1871469 spots for SRR9668928.sra Read 1871470 spots for SRR9668928.sra Written 1871470 spots for SRR9668928.sra Read 1871469 spots for SRR9668928.sra Written 1871469 spots for SRR9668928.sra Read 1871469 spots for SRR9668928.sra Written 1871469 spots for SRR9668928.sra Read 1871469 spots for SRR9668928.sra Written 1871469 spots for SRR9668928.sra SRR ids: ['SRR9668928.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ma6_4avc SRR9668928.sra spots: 37429381 blocks: [[1, 1871469], [1871470, 3742938], [3742939, 5614407], [5614408, 7485876], [7485877, 9357345], [9357346, 11228814], [11228815, 13100283], [13100284, 14971752], [14971753, 16843221], [16843222, 18714690], [18714691, 20586159], [20586160, 22457628], [22457629, 24329097], [24329098, 26200566], [26200567, 28072035], [28072036, 29943504], [29943505, 31814973], [31814974, 33686442], [33686443, 35557911], [35557912, 37429381]] SRR9668928 file size 7106716 SRR9668928 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR9668928 SRR9668928_1.fastq SRR9668928_2.fastq Input file: SRR9668928_1.fastq Paired file: SRR9668928_2.fastq trimmed: SRR9668928-trimmed-pair1.fastq, SRR9668928-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 17:48:07 2025 >> started Wed Feb 12 17:48:39 2025 >> done (31.852s) 37429381 read pairs processed; of these: 20 ( 0.00%) short read pairs filtered out after trimming by size control 4368 ( 0.01%) empty read pairs filtered out after trimming by size control 37424993 (99.99%) read pairs available; of these: 6522 ( 0.02%) trimmed read pairs available after processing 37418471 (99.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 1 0.00% 21 1 0.00% 22 4 0.00% 23 7 0.00% 24 11 0.00% 25 8 0.00% 26 11 0.00% 27 19 0.00% 28 16 0.00% 29 33 0.00% 30 24 0.00% 31 32 0.00% 32 34 0.00% 33 30 0.00% 34 24 0.00% 35 170 0.00% 36 167 0.00% 37 194 0.00% 38 195 0.00% 39 209 0.00% 40 225 0.00% 41 267 0.00% 42 284 0.00% 43 359 0.00% 44 393 0.00% 45 430 0.00% 46 366 0.00% 47 462 0.00% 48 546 0.00% 49 658 0.00% 50 758 0.00% 51 970 0.00% 52 943 0.00% 53 946 0.00% 54 1104 0.00% 55 1523 0.00% 56 1633 0.00% 57 1712 0.00% 58 1869 0.00% 59 1964 0.01% 60 2336 0.01% 61 2346 0.01% 62 2784 0.01% 63 3058 0.01% 64 3181 0.01% 65 3622 0.01% 66 3862 0.01% 67 4378 0.01% 68 4424 0.01% 69 4959 0.01% 70 6579 0.02% 71 9687 0.03% 72 28514 0.08% 73 315397 0.84% 74 3015364 8.06% 75 17984936 48.06% 76 16010963 42.78% 37424993 reads passed initial QC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=22 prefix-density=0.49 prefix-fanout=2.2 sequence=CTGATGCACTGCACTTGACG criterion=fanout-score sequence-density=0.05 sequence-density-rank=31 fanout-score=12.31 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=2.1 sequence=CGCATCGCCGGTAGAAGGGACGAGGCGACCGGTGCACACCTGAGGCGGACCGGCCGACCCAACCCAAAGTCCAACTACGAGCTTTTTAACTGCAACAACTTAAATATACGCTATTGGAGCTGGAATTACCGCGGCTGCTGGCACCAGACTTGCCCTCCAATGGATCCTCGTTAAGGGATTTAGATTGTACTCATTCCAATTACCAGACTCGAAGAGCCCGGTATTGTTATTTATTGTCACTACCTCCCCGTGTCAGGATTGGGTAATTTGCGCGCCTGCTGCCTTCCTTGGATGTGGTAGCCGTTTCTCAGGCTCCCTCTCCGGAATCGAACCCTAATTCTCCGTCACCCGTCACCACCATGGTAGGCCTCTATCCTACCATCGAAAGTTGATAGGGCAGAAATTTGAATGATGCGTCGCCAGCACGAAGGCCGTGCGATCCGTCGAGTTATCATGAATCATCAGAGCAACGGGCAGAGCCCGCGTCGACCTTTTATCTAATAAATGCGTC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=29 prefix-density=0.38 prefix-fanout=1.9 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=26.82 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=3.0 sequence=TGCAGATCTTGGTGGTAGTAGCAAATATTCAAATGAGAACTTTGAAGGCCGAAGAGGGGAAAGGTTCCATGTGAACGGCACTTGCACATGGGTTAGTCGATCCTAAGAGACGGGGGAAGCCCGTCCGACAGCGCGTTCGCGCGCGAGCTTCGAAAGGGAATCGGGTTAAAATTCCTGAACCGGGACGTGGCGGCTGACGGCAACGTTAGGGAGTCCGGAGACGTCGGCGGGGGCCTCGGGAAGAGTTATCTTTTCTGTTTAACAGCCCGCCCACCCTGGAAACGACTTAGTCGGAGGTAGGGTCCAGCGGCTGGAAGAGCACCGCACGTCGCGTGGTGTCCGGTGCGCCCCCGGCGGCCCTTGAAAATCCGGAGGACCGAGTGCCTCCCACGCCCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAACAGCCTCTGGTCGATGGAACAATGTAGGCAAGGGAAGTCGGCAAAATGGATCCGTAACCTCGGGAAAAGGATTGGCTCT SRR9668928 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 17:49:07 Started mapping on | Feb 12 17:49:07 Finished on | Feb 12 17:51:31 Mapping speed, Million of reads per hour | 935.62 Number of input reads | 37424993 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 30965660 Uniquely mapped reads % | 82.74% Average mapped length | 150.37 Number of splices: Total | 13395235 Number of splices: Annotated (sjdb) | 13247235 Number of splices: GT/AG | 13153385 Number of splices: GC/AG | 205266 Number of splices: AT/AC | 9894 Number of splices: Non-canonical | 26690 Mismatch rate per base, % | 0.51% Deletion rate per base | 0.02% Deletion average length | 2.17 Insertion rate per base | 0.02% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1541294 % of reads mapped to multiple loci | 4.12% Number of reads mapped to too many loci | 3520054 % of reads mapped to too many loci | 9.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.28% % of reads unmapped: other | 0.45% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4918098 4918098 4918098 N_multimapping 1541294 1541294 1541294 N_noFeature 1594118 30538469 1711566 N_ambiguous 472581 1831 161320 UnstrandedReadsAssigned:28898961 PositiveStrandReadsAssigned:425360 NegativeStrandReadsAssigned:29092774 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR9668928 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR9668928-trimmed-pair1.fastq SRR9668928-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 37,424,993 reads, 32,076,399 reads pseudoaligned [quant] estimated average fragment length: 197.868 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,046 rounds 52401 SRR9668928.ke.tsv 34699 SRR9668928.se.tsv 87100 total ==> SRR9668928.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1821.13 768 10.8072 Potri.005G024800.1.v4.1 1035 838.132 185 5.65659 Potri.004G059700.1.v4.1 961 764.132 67 2.24699 Potri.007G009000.2.v4.1 1416 1219.13 0 0 Potri.003G141000.2.v4.1 2943 2746.13 652.368 6.08788 Potri.016G087400.1.v4.1 270 89.9522 2051.69 584.515 Potri.015G069301.1.v4.1 564 367.285 0 0 Potri.010G195200.1.v4.1 1773 1576.13 14.3057 0.232602 Potri.012G127500.1.v4.1 977 780.132 9640 316.668 ==> SRR9668928.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 71 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 509 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 186 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 24 SRR9668928 completed mapping pipeline successfully