Starting /dee2/code/volunteer_pipeline.sh SRR9668929 current disk space = 3051930595328 free memory = 1488557132 SRR9668929 SRAfilesize 46f1a5c3c587d7b5fc03d08b924fc6ea SRR9668929.sra SRR9668929.sra file validated SRR9668929 is paired end SRR9668929 is conventional basespace SRR9668929 read1 length is 63-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668929_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 63-76 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.52475 32.0 32.0 32.0 32.0 32.0 2 31.52225 32.0 32.0 32.0 32.0 32.0 3 31.62725 32.0 32.0 32.0 32.0 32.0 4 31.6525 32.0 32.0 32.0 32.0 32.0 5 31.6195 32.0 32.0 32.0 32.0 32.0 6 34.7175 36.0 36.0 36.0 36.0 36.0 7 35.29225 36.0 36.0 36.0 36.0 36.0 8 35.2325 36.0 36.0 36.0 36.0 36.0 9 35.25025 36.0 36.0 36.0 36.0 36.0 10-11 35.22625 36.0 36.0 36.0 36.0 36.0 12-13 35.151375 36.0 36.0 36.0 36.0 36.0 14-15 35.114000000000004 36.0 36.0 36.0 36.0 36.0 16-17 35.164 36.0 36.0 36.0 36.0 36.0 18-19 35.17275 36.0 36.0 36.0 36.0 36.0 20-21 35.184625 36.0 36.0 36.0 36.0 36.0 22-23 35.086124999999996 36.0 36.0 36.0 36.0 36.0 24-25 35.108125 36.0 36.0 36.0 36.0 36.0 26-27 35.064375 36.0 36.0 36.0 36.0 36.0 28-29 35.033 36.0 36.0 36.0 36.0 36.0 30-31 35.05375 36.0 36.0 36.0 36.0 36.0 32-33 34.969125 36.0 36.0 36.0 36.0 36.0 34-35 35.018375 36.0 36.0 36.0 36.0 36.0 36-37 34.9225 36.0 36.0 36.0 36.0 36.0 38-39 34.916124999999994 36.0 36.0 36.0 36.0 36.0 40-41 34.838499999999996 36.0 36.0 36.0 36.0 36.0 42-43 34.850875 36.0 36.0 36.0 36.0 36.0 44-45 34.926375 36.0 36.0 36.0 36.0 36.0 46-47 34.871375 36.0 36.0 36.0 36.0 36.0 48-49 34.86024999999999 36.0 36.0 36.0 36.0 36.0 50-51 34.87225 36.0 36.0 36.0 36.0 36.0 52-53 34.79175 36.0 36.0 36.0 34.0 36.0 54-55 34.837875 36.0 36.0 36.0 34.0 36.0 56-57 34.6785 36.0 36.0 36.0 32.0 36.0 58-59 34.788624999999996 36.0 36.0 36.0 32.0 36.0 60-61 34.565 36.0 36.0 36.0 32.0 36.0 62-63 34.540625 36.0 36.0 36.0 32.0 36.0 64-65 34.48087021755439 36.0 36.0 36.0 32.0 36.0 66-67 34.468242060515124 36.0 36.0 36.0 32.0 36.0 68-69 34.47380814062946 36.0 36.0 36.0 32.0 36.0 70-71 34.484738553915435 36.0 36.0 36.0 32.0 36.0 72-73 34.44898628196175 36.0 36.0 36.0 32.0 36.0 74-75 34.36770604629412 36.0 36.0 36.0 32.0 36.0 76 33.573828125 36.0 32.0 36.0 27.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 2.0 24 4.0 25 12.0 26 19.0 27 25.0 28 40.0 29 65.0 30 89.0 31 99.0 32 149.0 33 259.0 34 521.0 35 2714.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.425 14.099999999999998 10.725 42.75 2 21.05 18.3 38.224999999999994 22.425 3 18.85 22.475 24.825 33.85 4 21.85 30.575000000000003 23.175 24.4 5 22.525000000000002 35.6 23.35 18.525 6 18.796037592075184 34.34086868173736 25.06985013970028 21.793243586487172 7 13.725000000000001 23.275000000000002 44.625 18.375 8 18.3 22.925 32.625 26.150000000000002 9 18.475 23.525 33.550000000000004 24.45 10-11 21.7875 31.112499999999997 24.4125 22.6875 12-13 20.200000000000003 25.374999999999996 28.5875 25.837500000000002 14-15 20.3125 27.125 28.0875 24.474999999999998 16-17 20.3125 27.35 27.975 24.3625 18-19 20.1875 28.1125 27.525 24.175 20-21 21.1375 27.237499999999997 27.625 24.0 22-23 20.5 28.3625 26.8375 24.3 24-25 21.224999999999998 27.787499999999998 26.474999999999998 24.5125 26-27 20.9 27.787499999999998 27.075 24.2375 28-29 20.6875 28.849999999999998 26.974999999999998 23.4875 30-31 20.4875 28.375 26.387500000000003 24.75 32-33 21.125 27.9125 26.6125 24.349999999999998 34-35 20.9125 27.925 27.3 23.8625 36-37 20.849999999999998 27.625 27.1625 24.3625 38-39 21.224999999999998 27.925 26.2625 24.587500000000002 40-41 20.325 28.449999999999996 26.0 25.224999999999998 42-43 21.6125 27.250000000000004 26.125 25.0125 44-45 20.7375 28.000000000000004 27.2625 24.0 46-47 20.549999999999997 28.000000000000004 26.437500000000004 25.0125 48-49 21.425 28.787499999999998 25.7125 24.075 50-51 21.4875 27.375 26.8375 24.3 52-53 21.0625 28.1375 26.575 24.224999999999998 54-55 20.7 27.8875 27.175 24.2375 56-57 19.5875 27.375 27.500000000000004 25.5375 58-59 20.9375 28.449999999999996 26.1125 24.5 60-61 20.8 27.987499999999997 26.8375 24.375 62-63 21.099999999999998 28.1875 26.375 24.337500000000002 64-65 21.030257564391096 28.49462365591398 26.744186046511626 23.730932733183295 66-67 20.930232558139537 27.819454863715933 26.431607901975497 24.81870467616904 68-69 21.28298111791922 28.010503938977116 26.50994122796049 24.19657371514318 70-71 21.541155866900176 27.145359019264447 27.1703777833375 24.143107330497873 72-73 20.813968094460495 27.998995101117952 25.888707448812966 25.29832935560859 74-75 20.54025140411875 24.69911741107248 28.737630382455205 26.023000802353568 76 23.1640625 0.0 39.375 37.4609375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 1.5 20 1.5 21 1.5 22 3.0 23 4.0 24 5.5 25 8.0 26 9.5 27 11.5 28 15.0 29 18.5 30 26.0 31 42.5 32 54.5 33 61.5 34 76.5 35 89.0 36 114.5 37 144.5 38 162.0 39 190.0 40 220.5 41 235.5 42 252.0 43 274.0 44 284.5 45 292.0 46 301.0 47 295.0 48 281.5 49 260.0 50 233.0 51 217.0 52 192.0 53 164.5 54 145.0 55 127.5 56 110.0 57 84.0 58 67.5 59 60.5 60 43.5 61 30.0 62 25.5 63 17.5 64 7.5 65 3.5 66 4.5 67 5.5 68 2.5 69 1.0 70 1.5 71 1.0 72 2.0 73 2.0 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 1.575 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 63 1.0 64 0.0 65 0.0 66 0.0 67 0.0 68 1.0 69 1.0 70 0.0 71 5.0 72 23.0 73 85.0 74 290.0 75 1034.0 76 2560.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.75 #Duplication Level Percentage of deduplicated Percentage of total 1 98.8860759493671 97.65 2 0.9873417721518988 1.95 3 0.10126582278481014 0.3 4 0.025316455696202535 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR9668929 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668929_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.2395 32.0 32.0 32.0 32.0 32.0 2 31.063 32.0 32.0 32.0 32.0 32.0 3 31.01925 32.0 32.0 32.0 32.0 32.0 4 31.16175 32.0 32.0 32.0 32.0 32.0 5 31.055 32.0 32.0 32.0 32.0 32.0 6 34.4715 36.0 36.0 36.0 32.0 36.0 7 34.71475 36.0 36.0 36.0 32.0 36.0 8 34.44775 36.0 36.0 36.0 32.0 36.0 9 34.5945 36.0 36.0 36.0 32.0 36.0 10-11 34.4695 36.0 36.0 36.0 32.0 36.0 12-13 34.57525 36.0 36.0 36.0 32.0 36.0 14-15 34.463375 36.0 36.0 36.0 32.0 36.0 16-17 34.5085 36.0 36.0 36.0 32.0 36.0 18-19 34.405 36.0 36.0 36.0 32.0 36.0 20-21 34.4375 36.0 36.0 36.0 32.0 36.0 22-23 34.35025 36.0 36.0 36.0 32.0 36.0 24-25 34.332 36.0 36.0 36.0 32.0 36.0 26-27 34.33775 36.0 36.0 36.0 32.0 36.0 28-29 34.25125 36.0 36.0 36.0 32.0 36.0 30-31 34.237875 36.0 36.0 36.0 32.0 36.0 32-33 34.153375 36.0 36.0 36.0 32.0 36.0 34-35 34.226749999999996 36.0 36.0 36.0 32.0 36.0 36-37 34.298922575795544 36.0 36.0 36.0 32.0 36.0 38-39 34.068028063142066 36.0 36.0 36.0 32.0 36.0 40-41 34.11613630669005 36.0 36.0 36.0 32.0 36.0 42-43 33.942357177082016 36.0 36.0 36.0 32.0 36.0 44-45 33.907076459337006 36.0 36.0 36.0 32.0 36.0 46-47 33.95145509282489 36.0 36.0 36.0 32.0 36.0 48-49 34.12722710163112 36.0 36.0 36.0 32.0 36.0 50-51 34.043663739021326 36.0 36.0 36.0 32.0 36.0 52-53 34.01116687578419 36.0 36.0 36.0 32.0 36.0 54-55 33.85495608531995 36.0 36.0 36.0 32.0 36.0 56-57 33.69686323713927 36.0 36.0 36.0 29.5 36.0 58-59 33.712672521957344 36.0 36.0 36.0 29.5 36.0 60-61 33.782936010037645 36.0 36.0 36.0 27.0 36.0 62-63 33.77867001254705 36.0 36.0 36.0 27.0 36.0 64-65 33.66880020080322 36.0 36.0 36.0 27.0 36.0 66-67 33.541792168674704 36.0 36.0 36.0 27.0 36.0 68-69 33.67755751855022 36.0 36.0 36.0 27.0 36.0 70-71 33.73850791258478 36.0 36.0 36.0 27.0 36.0 72-73 33.62467579816893 36.0 36.0 36.0 27.0 36.0 74-75 33.634195978277695 36.0 36.0 36.0 27.0 36.0 76 32.588641596316194 36.0 32.0 36.0 21.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 1.0 13 0.0 14 4.0 15 4.0 16 11.0 17 6.0 18 11.0 19 6.0 20 10.0 21 13.0 22 10.0 23 19.0 24 21.0 25 26.0 26 38.0 27 51.0 28 65.0 29 86.0 30 121.0 31 132.0 32 158.0 33 288.0 34 580.0 35 2329.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.730238393977416 20.125470514429107 14.077791718946047 31.066499372647428 2 29.678876066231812 23.206221776216758 32.96537882589062 14.149523331660813 3 22.932330827067666 26.61654135338346 29.04761904761905 21.403508771929825 4 26.058631921824105 32.748684540215486 21.44825858180907 19.74442495615134 5 26.584815835630167 35.40466048609371 21.147582059634175 16.862941618641944 6 21.122525682786268 37.083437734903534 21.723878727136057 20.07015785517414 7 20.646454522676024 18.26609872212478 39.38862440491105 21.69882235028815 8 22.37534452518166 23.903783512904035 27.261338010523676 26.45953395139063 9 23.076923076923077 24.204460035078927 27.862691054873466 24.85592583312453 10-11 25.018792282635932 31.01979453770985 22.199949887246305 21.761463292407917 12-13 24.31721373089451 25.63267351540967 27.048358807316465 23.001753946379353 14-15 24.194963037213384 27.227164515724844 26.901390803157497 21.67648164390427 16-17 24.736710130391174 27.143931795386155 26.479438314944836 21.639919759277834 18-19 24.17940365823102 26.49711851666249 26.45953395139063 22.86394387371586 20-21 24.868388067184757 26.63574830784658 26.736024066182 21.759839558786666 22-23 24.21277129594781 26.78459415380755 26.99786726884958 22.004767281395058 24-25 24.454750564051142 27.162196039107545 27.049385810980198 21.333667585861118 26-27 24.27962916562265 27.148584314708092 26.81032322726134 21.761463292407917 28-29 24.805618259342864 27.389014296463504 26.3481314271382 21.457236017055433 30-31 24.73334169908395 26.301919939766595 26.728573221232278 22.23616513991718 32-33 24.454477050413846 27.501881113619262 26.56132430398796 21.482317531978932 34-35 25.978424485699954 27.00702458605118 26.103863522328147 20.910687405920722 36-37 24.959196484620215 26.96798493408663 26.60389202762084 21.468926553672315 38-39 24.836601307189543 27.300150829562593 26.784816490698844 21.07843137254902 40-41 25.056689342403626 27.286470143613002 26.190476190476193 21.466364323507182 42-43 23.493064312736443 27.30138713745271 27.490542244640604 21.715006305170238 44-45 23.463334595481513 27.565316168118137 26.959485043544113 22.011864192856244 46-47 24.883339639298775 27.027367890023964 26.03102534998108 22.05826712069618 48-49 24.393920361763595 27.144831051375455 26.529330486119836 21.931918100741115 50-51 24.770757442532346 26.75543273458108 27.672402964451702 20.80140685843487 52-53 24.33689503456945 27.102451288497797 27.743557510999374 20.817096165933375 54-55 24.319899244332493 27.581863979848865 26.30982367758186 21.788413098236774 56-57 24.97793468667255 27.751859790694745 26.22620098348254 21.044004539150173 58-59 25.110298752048404 26.77423421152149 26.812050926509517 21.303416109920583 60-61 24.97175141242938 26.70433145009416 26.64155681104834 21.682360326428125 62-63 24.246231155778894 27.449748743718594 27.110552763819097 21.193467336683415 64-65 25.14804082146907 26.470958800554367 27.51669396497417 20.864306413002392 66-67 23.93496344844971 27.350642803125787 26.947315351651124 21.767078396773382 68-69 24.134893670567507 26.90323392475148 27.595318988297468 21.366553416383542 70-71 24.42517904259329 28.345269506219374 26.20932277924362 21.020228671943713 72-73 24.126623786101653 27.93542691386051 26.913860512044398 21.024088787993442 74-75 24.946581196581196 23.477564102564102 28.47222222222222 23.10363247863248 76 26.90978886756238 0.0 39.923224568138195 33.16698656429942 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 9.0 1 4.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.5 11 0.5 12 0.0 13 0.5 14 1.0 15 1.0 16 1.5 17 2.0 18 1.5 19 1.0 20 1.5 21 2.0 22 2.0 23 2.5 24 5.0 25 6.0 26 8.0 27 10.0 28 13.0 29 16.5 30 22.0 31 28.5 32 38.0 33 48.5 34 58.5 35 80.0 36 98.5 37 117.0 38 143.5 39 176.0 40 207.5 41 241.0 42 263.5 43 290.0 44 321.0 45 321.0 46 316.5 47 314.0 48 298.0 49 273.0 50 248.5 51 218.5 52 187.0 53 148.5 54 120.5 55 117.5 56 104.0 57 77.5 58 65.5 59 58.5 60 44.0 61 33.5 62 27.0 63 17.5 64 8.0 65 7.0 66 6.5 67 5.5 68 5.0 69 4.0 70 2.5 71 1.5 72 2.5 73 2.0 74 0.5 75 0.5 76 1.0 77 1.0 78 0.5 79 0.0 80 0.0 81 0.5 82 1.0 83 1.0 84 1.5 85 1.5 86 0.5 87 0.0 88 0.5 89 1.0 90 0.5 91 0.5 92 1.0 93 1.0 94 0.5 95 1.5 96 3.0 97 2.0 98 0.5 99 10.0 100 20.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.375 2 0.35000000000000003 3 0.25 4 0.22499999999999998 5 0.22499999999999998 6 0.22499999999999998 7 0.22499999999999998 8 0.22499999999999998 9 0.22499999999999998 10-11 0.22499999999999998 12-13 0.22499999999999998 14-15 0.2375 16-17 0.3 18-19 0.22499999999999998 20-21 0.27499999999999997 22-23 0.36250000000000004 24-25 0.27499999999999997 26-27 0.22499999999999998 28-29 0.325 30-31 0.3875 32-33 0.325 34-35 0.35000000000000003 36-37 0.21297920320721622 38-39 0.32573289902280134 40-41 0.5512402906539714 42-43 0.6390176669590277 44-45 0.664493480441324 46-47 0.5393878575012544 48-49 0.11292346298619825 50-51 0.11292346298619825 52-53 0.18820577164366373 54-55 0.37641154328732745 56-57 0.4893350062735257 58-59 0.4642409033877039 60-61 0.06273525721455457 62-63 0.12547051442910914 64-65 0.38905622489959835 66-67 0.426706827309237 68-69 0.25103552152629593 70-71 0.037678975131876416 72-73 0.07561436672967864 74-75 0.0267022696929239 76 0.03837298541826554 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 9.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 1.0 43 0.0 44 4.0 45 0.0 46 0.0 47 1.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 1.0 64 0.0 65 0.0 66 0.0 67 0.0 68 1.0 69 2.0 70 0.0 71 4.0 72 19.0 73 72.0 74 282.0 75 998.0 76 2606.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.975 #Duplication Level Percentage of deduplicated Percentage of total 1 98.7496810410819 96.75 2 1.0717019647869355 2.1 3 0.10206685378923194 0.3 4 0.025516713447307986 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025516713447307986 0.22499999999999998 >10 0.025516713447307986 0.525 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 21 0.525 No Hit NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 9 0.22499999999999998 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1915721 spots for SRR9668929.sra Written 1915721 spots for SRR9668929.sra Read 1915721 spots for SRR9668929.sra Written 1915721 spots for SRR9668929.sra Read 1915721 spots for SRR9668929.sra Written 1915721 spots for SRR9668929.sra Read 1915721 spots for SRR9668929.sra Written 1915721 spots for SRR9668929.sra Read 1915721 spots for SRR9668929.sra Written 1915721 spots for SRR9668929.sra Read 1915721 spots for SRR9668929.sra Written 1915721 spots for SRR9668929.sra Read 1915721 spots for SRR9668929.sra Written 1915721 spots for SRR9668929.sra Read 1915721 spots for SRR9668929.sra Written 1915721 spots for SRR9668929.sra Read 1915721 spots for SRR9668929.sra Written 1915721 spots for SRR9668929.sra Read 1915721 spots for SRR9668929.sra Written 1915721 spots for SRR9668929.sra Read 1915739 spots for SRR9668929.sra Written 1915739 spots for SRR9668929.sra Read 1915721 spots for SRR9668929.sra Written 1915721 spots for SRR9668929.sra Read 1915721 spots for SRR9668929.sra Written 1915721 spots for SRR9668929.sra Read 1915721 spots for SRR9668929.sra Written 1915721 spots for SRR9668929.sra Read 1915721 spots for SRR9668929.sra Written 1915721 spots for SRR9668929.sra Read 1915721 spots for SRR9668929.sra Written 1915721 spots for SRR9668929.sra Read 1915721 spots for SRR9668929.sra Written 1915721 spots for SRR9668929.sra Read 1915721 spots for SRR9668929.sra Written 1915721 spots for SRR9668929.sra Read 1915721 spots for SRR9668929.sra Written 1915721 spots for SRR9668929.sra Read 1915721 spots for SRR9668929.sra Written 1915721 spots for SRR9668929.sra SRR ids: ['SRR9668929.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_epbrdzka SRR9668929.sra spots: 38314438 blocks: [[1, 1915721], [1915722, 3831442], [3831443, 5747163], [5747164, 7662884], [7662885, 9578605], [9578606, 11494326], [11494327, 13410047], [13410048, 15325768], [15325769, 17241489], [17241490, 19157210], [19157211, 21072931], [21072932, 22988652], [22988653, 24904373], [24904374, 26820094], [26820095, 28735815], [28735816, 30651536], [30651537, 32567257], [32567258, 34482978], [34482979, 36398699], [36398700, 38314438]] SRR9668929 file size 7274702 SRR9668929 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR9668929 SRR9668929_1.fastq SRR9668929_2.fastq Input file: SRR9668929_1.fastq Paired file: SRR9668929_2.fastq trimmed: SRR9668929-trimmed-pair1.fastq, SRR9668929-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 17:09:58 2025 >> started Wed Feb 12 17:10:29 2025 >> done (31.239s) 38314438 read pairs processed; of these: 29 ( 0.00%) short read pairs filtered out after trimming by size control 5009 ( 0.01%) empty read pairs filtered out after trimming by size control 38309400 (99.99%) read pairs available; of these: 7227 ( 0.02%) trimmed read pairs available after processing 38302173 (99.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 6 0.00% 21 3 0.00% 22 4 0.00% 23 5 0.00% 24 9 0.00% 25 11 0.00% 26 9 0.00% 27 29 0.00% 28 17 0.00% 29 34 0.00% 30 31 0.00% 31 28 0.00% 32 29 0.00% 33 23 0.00% 34 48 0.00% 35 178 0.00% 36 183 0.00% 37 197 0.00% 38 198 0.00% 39 227 0.00% 40 250 0.00% 41 276 0.00% 42 306 0.00% 43 362 0.00% 44 427 0.00% 45 417 0.00% 46 360 0.00% 47 467 0.00% 48 602 0.00% 49 639 0.00% 50 805 0.00% 51 908 0.00% 52 931 0.00% 53 936 0.00% 54 1064 0.00% 55 1575 0.00% 56 1588 0.00% 57 1600 0.00% 58 1781 0.00% 59 1958 0.01% 60 2110 0.01% 61 2178 0.01% 62 2400 0.01% 63 2597 0.01% 64 2869 0.01% 65 3104 0.01% 66 3401 0.01% 67 3870 0.01% 68 3821 0.01% 69 4427 0.01% 70 5913 0.02% 71 8660 0.02% 72 28417 0.07% 73 335106 0.87% 74 3155426 8.24% 75 18556641 48.44% 76 16169936 42.21% 38309400 reads passed initial QC criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=2.30 fanout-score-rank=17 prefix-density=0.63 prefix-fanout=2.2 sequence=CTGATGCACTGCACTTGACG criterion=fanout-score sequence-density=0.09 sequence-density-rank=25 fanout-score=10.98 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=6.1 sequence=GCTCCAAGCATGGCCCACCTGGAATGGATGACTTCAAGCTCACGGTTCTTGGCAAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCAGCCGTAGTCACCAGGGAACTCACCAGTCAAGTAGGATGGGGGCTCACCAGAGAACGGGCCCAAGTATTTAACACGGTCTGGTCCGTACCATGGGCTCCCGGAGGGAACAGGCTTGGTGGTTTTCCTCATGGAGACACGGCCATTGCCCATGATCTCAGAGGAGGAGGGGTTGAGCTTCACC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=25 prefix-density=0.50 prefix-fanout=1.9 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=26 fanout-score=23.75 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=3.3 sequence=CAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR9668929 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 17:10:56 Started mapping on | Feb 12 17:10:56 Finished on | Feb 12 17:12:46 Mapping speed, Million of reads per hour | 1253.76 Number of input reads | 38309400 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 33498505 Uniquely mapped reads % | 87.44% Average mapped length | 150.42 Number of splices: Total | 14761462 Number of splices: Annotated (sjdb) | 14601530 Number of splices: GT/AG | 14489048 Number of splices: GC/AG | 234493 Number of splices: AT/AC | 9240 Number of splices: Non-canonical | 28681 Mismatch rate per base, % | 0.47% Deletion rate per base | 0.02% Deletion average length | 2.16 Insertion rate per base | 0.01% Insertion average length | 2.02 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1455309 % of reads mapped to multiple loci | 3.80% Number of reads mapped to too many loci | 1690387 % of reads mapped to too many loci | 4.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.14% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3355647 3355647 3355647 N_multimapping 1455309 1455309 1455309 N_noFeature 1063959 33063535 1193634 N_ambiguous 495698 1616 189167 UnstrandedReadsAssigned:31938848 PositiveStrandReadsAssigned:433354 NegativeStrandReadsAssigned:32115704 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR9668929 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR9668929-trimmed-pair1.fastq SRR9668929-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 38,309,400 reads, 34,119,580 reads pseudoaligned [quant] estimated average fragment length: 198.887 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,287 rounds 52401 SRR9668929.ke.tsv 34699 SRR9668929.se.tsv 87100 total ==> SRR9668929.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1820.11 796 10.9159 Potri.005G024800.1.v4.1 1035 837.113 160 4.77067 Potri.004G059700.1.v4.1 961 763.117 68 2.22414 Potri.007G009000.2.v4.1 1416 1218.11 0 0 Potri.003G141000.2.v4.1 2943 2745.11 629.256 5.72151 Potri.016G087400.1.v4.1 270 88.7278 2160.31 607.714 Potri.015G069301.1.v4.1 564 366.332 0 0 Potri.010G195200.1.v4.1 1773 1575.11 13.1666 0.208644 Potri.012G127500.1.v4.1 977 779.117 7136 228.61 ==> SRR9668929.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 37 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 610 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 167 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 13 SRR9668929 completed mapping pipeline successfully