Starting /dee2/code/volunteer_pipeline.sh SRR9668930 current disk space = 3051953664000 free memory = 1415865940 SRR9668930 SRAfilesize 7c2b91f52b17e67ba7bb6888b9115820 SRR9668930.sra SRR9668930.sra file validated SRR9668930 is paired end SRR9668930 is conventional basespace SRR9668930 read1 length is 64-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668930_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 64-76 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.51875 32.0 32.0 32.0 32.0 32.0 2 31.565 32.0 32.0 32.0 32.0 32.0 3 31.578 32.0 32.0 32.0 32.0 32.0 4 31.639 32.0 32.0 32.0 32.0 32.0 5 31.61275 32.0 32.0 32.0 32.0 32.0 6 34.688 36.0 36.0 36.0 36.0 36.0 7 35.23775 36.0 36.0 36.0 36.0 36.0 8 35.2225 36.0 36.0 36.0 36.0 36.0 9 35.24125 36.0 36.0 36.0 36.0 36.0 10-11 35.102375 36.0 36.0 36.0 36.0 36.0 12-13 35.06425 36.0 36.0 36.0 36.0 36.0 14-15 35.087625 36.0 36.0 36.0 36.0 36.0 16-17 35.174875 36.0 36.0 36.0 36.0 36.0 18-19 35.15925 36.0 36.0 36.0 36.0 36.0 20-21 35.147875 36.0 36.0 36.0 36.0 36.0 22-23 35.030874999999995 36.0 36.0 36.0 36.0 36.0 24-25 35.01225 36.0 36.0 36.0 36.0 36.0 26-27 34.934375 36.0 36.0 36.0 36.0 36.0 28-29 35.051500000000004 36.0 36.0 36.0 36.0 36.0 30-31 35.022625000000005 36.0 36.0 36.0 36.0 36.0 32-33 34.95825000000001 36.0 36.0 36.0 36.0 36.0 34-35 34.83025 36.0 36.0 36.0 34.0 36.0 36-37 34.945750000000004 36.0 36.0 36.0 36.0 36.0 38-39 34.958875 36.0 36.0 36.0 36.0 36.0 40-41 34.838375 36.0 36.0 36.0 34.0 36.0 42-43 34.79975 36.0 36.0 36.0 36.0 36.0 44-45 34.870875 36.0 36.0 36.0 36.0 36.0 46-47 34.867999999999995 36.0 36.0 36.0 36.0 36.0 48-49 34.85275 36.0 36.0 36.0 36.0 36.0 50-51 34.673875 36.0 36.0 36.0 32.0 36.0 52-53 34.745374999999996 36.0 36.0 36.0 32.0 36.0 54-55 34.69175 36.0 36.0 36.0 32.0 36.0 56-57 34.525875 36.0 36.0 36.0 32.0 36.0 58-59 34.6385 36.0 36.0 36.0 32.0 36.0 60-61 34.576375 36.0 36.0 36.0 32.0 36.0 62-63 34.473 36.0 36.0 36.0 32.0 36.0 64-65 34.38766663540885 36.0 36.0 36.0 32.0 36.0 66-67 34.43932645752305 36.0 36.0 36.0 32.0 36.0 68-69 34.44591887831747 36.0 36.0 36.0 32.0 36.0 70-71 34.39514029371129 36.0 36.0 36.0 32.0 36.0 72-73 34.4096845252442 36.0 36.0 36.0 32.0 36.0 74-75 34.31181789213453 36.0 36.0 36.0 32.0 36.0 76 33.32401378782076 36.0 32.0 36.0 27.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 3.0 23 4.0 24 8.0 25 10.0 26 17.0 27 32.0 28 44.0 29 54.0 30 87.0 31 113.0 32 167.0 33 257.0 34 549.0 35 2654.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.25 14.274999999999999 11.025 42.449999999999996 2 21.925 18.575 36.65 22.85 3 18.875 21.725 25.124999999999996 34.275 4 22.825 31.25 22.025 23.9 5 21.375 35.975 24.349999999999998 18.3 6 18.899036022323692 34.753932014205986 26.154236428209032 20.192795535261286 7 15.049999999999999 22.1 43.575 19.275000000000002 8 18.224999999999998 21.75 33.725 26.3 9 19.925 21.725 32.75 25.6 10-11 21.55 32.1 22.775000000000002 23.575 12-13 21.0625 24.7 28.175 26.0625 14-15 20.25 27.962500000000002 27.750000000000004 24.0375 16-17 21.4 27.3375 27.5125 23.75 18-19 20.474999999999998 27.8125 27.575 24.1375 20-21 21.45 27.500000000000004 27.287499999999998 23.7625 22-23 21.1125 27.400000000000002 27.075 24.4125 24-25 21.8 26.687499999999996 27.450000000000003 24.0625 26-27 20.825 27.437499999999996 27.275 24.462500000000002 28-29 20.75 28.125 26.275 24.85 30-31 20.724999999999998 27.6 26.974999999999998 24.7 32-33 20.4625 27.05 27.787499999999998 24.7 34-35 20.925 28.6125 26.2875 24.175 36-37 20.837500000000002 27.250000000000004 26.8125 25.1 38-39 20.8625 27.287499999999998 27.375 24.474999999999998 40-41 21.325 28.15 26.75 23.775 42-43 21.725 27.537499999999998 26.625 24.1125 44-45 20.775 27.575 26.987499999999997 24.6625 46-47 21.462500000000002 27.212500000000002 27.237499999999997 24.087500000000002 48-49 20.474999999999998 27.925 26.700000000000003 24.9 50-51 21.099999999999998 27.4125 27.4125 24.075 52-53 21.087500000000002 28.175 26.5 24.2375 54-55 21.2875 27.5875 26.35 24.775 56-57 19.8875 27.5875 27.275 25.25 58-59 21.349999999999998 28.425 26.687499999999996 23.5375 60-61 21.349999999999998 27.212500000000002 26.8625 24.575 62-63 20.6625 26.950000000000003 28.012500000000003 24.375 64-65 21.227653456682084 27.440930116264532 26.96587073384173 24.36554569321165 66-67 21.303477608206155 27.52064048036027 26.79509632224168 24.380785589191895 68-69 20.843765648472708 27.52879318978468 27.378567851777667 24.248873309964946 70-71 20.47076499311381 27.72004507324402 27.394516088644043 24.414673844998124 72-73 20.39457150037698 27.21789394320181 27.029404372958027 25.358130183463178 74-75 20.308141851507504 24.17319697170939 28.821888697038116 26.696772479744986 76 23.362696284948296 0.0 40.59747223286097 36.039831482190735 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 2.0 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.5 21 2.0 22 3.0 23 4.0 24 5.5 25 10.0 26 12.5 27 15.5 28 18.5 29 20.5 30 32.0 31 37.5 32 43.5 33 62.0 34 71.0 35 89.5 36 116.5 37 135.5 38 149.0 39 180.0 40 206.5 41 215.5 42 228.0 43 256.0 44 293.5 45 299.0 46 282.5 47 296.0 48 304.5 49 253.5 50 218.0 51 220.0 52 202.5 53 173.5 54 156.0 55 129.5 56 109.0 57 87.5 58 66.5 59 60.5 60 50.5 61 36.0 62 23.0 63 15.5 64 9.5 65 7.0 66 5.5 67 5.0 68 3.5 69 1.0 70 0.5 71 0.5 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 1.4500000000000002 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 64 1.0 65 1.0 66 2.0 67 2.0 68 0.0 69 0.0 70 1.0 71 7.0 72 14.0 73 73.0 74 269.0 75 1019.0 76 2611.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.375 #Duplication Level Percentage of deduplicated Percentage of total 1 98.6022871664549 97.0 2 1.1944091486658195 2.35 3 0.17789072426937738 0.525 4 0.0 0.0 5 0.025412960609911054 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGGCAATCGGACGGCGGGCGCACGCGTCGCATCTAGCCCGGATTCTGACT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR9668930 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668930_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.07925 32.0 32.0 32.0 32.0 32.0 2 31.047 32.0 32.0 32.0 32.0 32.0 3 30.9945 32.0 32.0 32.0 32.0 32.0 4 30.984 32.0 32.0 32.0 32.0 32.0 5 30.8435 32.0 32.0 32.0 32.0 32.0 6 34.48975 36.0 36.0 36.0 32.0 36.0 7 34.576 36.0 36.0 36.0 32.0 36.0 8 34.23325 36.0 36.0 36.0 32.0 36.0 9 34.41625 36.0 36.0 36.0 32.0 36.0 10-11 34.464 36.0 36.0 36.0 32.0 36.0 12-13 34.46775 36.0 36.0 36.0 32.0 36.0 14-15 34.39375 36.0 36.0 36.0 32.0 36.0 16-17 34.40875 36.0 36.0 36.0 32.0 36.0 18-19 34.390125 36.0 36.0 36.0 32.0 36.0 20-21 34.23425 36.0 36.0 36.0 32.0 36.0 22-23 34.253875 36.0 36.0 36.0 32.0 36.0 24-25 34.27575 36.0 36.0 36.0 32.0 36.0 26-27 34.144625000000005 36.0 36.0 36.0 32.0 36.0 28-29 34.201875 36.0 36.0 36.0 32.0 36.0 30-31 34.20925 36.0 36.0 36.0 32.0 36.0 32-33 34.104749999999996 36.0 36.0 36.0 32.0 36.0 34-35 34.158625 36.0 36.0 36.0 32.0 36.0 36-37 34.17338507761643 36.0 36.0 36.0 32.0 36.0 38-39 34.11579869804707 36.0 36.0 36.0 32.0 36.0 40-41 33.98435152729094 36.0 36.0 36.0 29.5 36.0 42-43 33.90309308816718 36.0 36.0 36.0 29.5 36.0 44-45 33.85312559928176 36.0 36.0 36.0 29.5 36.0 46-47 33.835923790423664 36.0 36.0 36.0 29.5 36.0 48-49 34.00314270085262 36.0 36.0 36.0 32.0 36.0 50-51 33.914242728184554 36.0 36.0 36.0 32.0 36.0 52-53 33.78347542627884 36.0 36.0 36.0 32.0 36.0 54-55 33.75238214643932 36.0 36.0 36.0 32.0 36.0 56-57 33.783851554664 36.0 36.0 36.0 29.5 36.0 58-59 33.62048645937813 36.0 36.0 36.0 27.0 36.0 60-61 33.57993664478564 36.0 36.0 36.0 27.0 36.0 62-63 33.62321204516938 36.0 36.0 36.0 27.0 36.0 64-65 33.45438775175987 36.0 36.0 36.0 27.0 36.0 66-67 33.55837740565704 36.0 36.0 36.0 27.0 36.0 68-69 33.46091982910279 36.0 36.0 36.0 27.0 36.0 70-71 33.60567981905001 36.0 36.0 36.0 27.0 36.0 72-73 33.50289300705444 36.0 36.0 36.0 27.0 36.0 74-75 33.535597782219185 36.0 36.0 36.0 27.0 36.0 76 32.44733773804897 36.0 32.0 36.0 21.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 2.0 11 0.0 12 1.0 13 0.0 14 3.0 15 6.0 16 10.0 17 3.0 18 8.0 19 11.0 20 11.0 21 11.0 22 14.0 23 15.0 24 27.0 25 26.0 26 41.0 27 61.0 28 78.0 29 88.0 30 114.0 31 140.0 32 174.0 33 331.0 34 587.0 35 2232.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.82948846539619 21.414242728184554 13.11434302908726 30.641925777331995 2 28.864946128789775 26.33425206715109 29.942370333249812 14.858431470809322 3 21.96343601302279 27.89882294014525 28.12421738041573 22.01352366641623 4 25.938908362543817 33.50025037556335 21.30696044066099 19.253880821231846 5 25.41311967951928 36.93039559339009 21.231847771657485 16.42463695543315 6 21.58237356034051 37.105658487731596 21.732598898347522 19.57936905358037 7 21.081622433650477 17.501251877816728 39.45918878317477 21.957936905358036 8 23.15973960941412 22.8592889334001 27.916875312969452 26.064096144216325 9 24.261392088132197 23.910866299449175 28.818227341011514 23.00951427140711 10-11 24.76214321482223 31.3970956434652 21.957936905358036 21.88282423635453 12-13 25.200300450676018 23.72308462694041 26.852779168753127 24.223835753630446 14-15 23.478587528174305 27.510643626346106 27.28524918607563 21.725519659403957 16-17 24.75557783905741 27.337678616194534 25.946352469290552 21.96039107545751 18-19 23.335002503755632 27.491236855282924 26.765147721582373 22.408612919379067 20-21 25.876753507014026 27.317134268537075 25.80160320641283 21.00450901803607 22-23 25.32614149523332 26.793778223783242 25.865529352734573 22.014550928248873 24-25 24.442495615134053 26.76021047356552 27.323978952643447 21.473314958656978 26-27 24.68703054581873 27.99198798197296 25.98898347521282 21.331997996995494 28-29 24.843319127600903 27.450488844321885 26.272248683880672 21.43394334419654 30-31 24.601681093965624 27.411868021578222 26.307866014301844 21.67858487015431 32-33 24.88716148445336 27.695586760280843 26.654964894684053 20.762286860581742 34-35 25.721093554050668 27.376473539001754 25.859041886129923 21.043391020817655 36-37 23.509476590937616 28.266599723860924 26.270867327726872 21.953056357474583 38-39 24.65753424657534 26.743747643584264 27.447530476310167 21.151187633530224 40-41 24.446680080482896 27.38933601609658 26.043762575452718 22.12022132796781 42-43 23.885671115588014 27.965248048350546 25.736590279526567 22.412490556534877 44-45 25.015760938091034 28.43273231622746 25.44445845416719 21.10704829151431 46-47 23.958202190608084 28.994082840236686 25.569683998489236 21.478030970665994 48-49 24.271356783919597 27.28643216080402 27.18592964824121 21.25628140703518 50-51 24.560301507537687 27.62562814070352 25.92964824120603 21.884422110552766 52-53 24.852294154619734 27.5801382778127 25.820238843494657 21.747328724072908 54-55 24.90566037735849 26.238993710691823 27.42138364779874 21.433962264150942 56-57 23.91441157960982 26.98552548772813 26.31843926998112 22.781623662680932 58-59 25.270712666834548 26.416519768320324 27.058675396625535 21.254092168219593 60-61 24.337228295011936 28.18193240356829 26.297273526824977 21.183565774594797 62-63 24.346076458752517 27.867203219315893 26.58450704225352 21.202213279678066 64-65 24.474644519944633 27.771486095381903 26.90323392475148 20.850635459921982 66-67 23.91085368924704 27.851926466884912 26.7564845127172 21.480735331150843 68-69 24.238227146814403 27.839335180055404 27.587509443465123 20.334928229665074 70-71 24.54111139049535 26.82926829268293 26.716117676640682 21.91350264018104 72-73 24.816780389183727 26.863785696234523 26.57316148597422 21.74627242860753 74-75 25.146980224478888 23.570283270978088 28.79476215927312 22.487974345269908 76 27.81019058732011 0.0 41.695838195254765 30.493971217425127 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 6.0 1 3.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 1.5 15 3.0 16 2.0 17 1.0 18 3.5 19 3.0 20 1.0 21 1.5 22 1.5 23 2.0 24 4.5 25 5.5 26 8.0 27 9.5 28 10.5 29 15.0 30 20.0 31 27.5 32 45.0 33 63.0 34 65.0 35 67.5 36 92.0 37 120.0 38 150.0 39 187.5 40 213.5 41 231.5 42 248.5 43 281.5 44 314.0 45 306.0 46 299.5 47 325.5 48 318.5 49 264.0 50 225.0 51 202.0 52 186.0 53 151.0 54 115.5 55 112.0 56 102.5 57 82.0 58 70.5 59 58.0 60 43.5 61 36.5 62 25.5 63 19.0 64 8.5 65 2.5 66 7.5 67 8.0 68 5.0 69 3.0 70 2.5 71 3.5 72 6.0 73 8.0 74 4.5 75 1.5 76 1.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 1.0 87 2.5 88 1.5 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 1.0 99 12.0 100 23.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.22499999999999998 3 0.17500000000000002 4 0.15 5 0.15 6 0.15 7 0.15 8 0.15 9 0.15 10-11 0.15 12-13 0.15 14-15 0.17500000000000002 16-17 0.27499999999999997 18-19 0.15 20-21 0.2 22-23 0.35000000000000003 24-25 0.22499999999999998 26-27 0.15 28-29 0.27499999999999997 30-31 0.36250000000000004 32-33 0.3 34-35 0.325 36-37 0.26289434151226837 38-39 0.38808212318477714 40-41 0.4506760140210316 42-43 0.5634155502691874 44-45 0.6140350877192983 46-47 0.4387064427174731 48-49 0.21311269900965274 50-51 0.20060180541624875 52-53 0.2632898696088265 54-55 0.3259779338014042 56-57 0.38866599799398194 58-59 0.4262788365095286 60-61 0.1630707476166583 62-63 0.2258469259723965 64-65 0.27606977036014557 66-67 0.2762430939226519 68-69 0.20105554159336514 70-71 0.050263885398341285 72-73 0.16399646776838653 74-75 0.05341880341880342 76 0.0777302759424796 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 6.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 1.0 43 2.0 44 2.0 45 0.0 46 0.0 47 0.0 48 1.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 1.0 60 2.0 61 0.0 62 0.0 63 0.0 64 1.0 65 1.0 66 2.0 67 2.0 68 0.0 69 0.0 70 0.0 71 7.0 72 17.0 73 77.0 74 268.0 75 1037.0 76 2573.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.75031879622546 96.8 2 1.0966590155572558 2.15 3 0.102014792144861 0.3 4 0.0 0.0 5 0.0 0.0 6 0.02550369803621525 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02550369803621525 0.6 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 24 0.6 No Hit NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1985886 spots for SRR9668930.sra Written 1985886 spots for SRR9668930.sra Read 1985886 spots for SRR9668930.sra Written 1985886 spots for SRR9668930.sra Read 1985886 spots for SRR9668930.sra Written 1985886 spots for SRR9668930.sra Read 1985886 spots for SRR9668930.sra Written 1985886 spots for SRR9668930.sra Read 1985886 spots for SRR9668930.sra Written 1985886 spots for SRR9668930.sra Read 1985886 spots for SRR9668930.sra Written 1985886 spots for SRR9668930.sra Read 1985886 spots for SRR9668930.sra Written 1985886 spots for SRR9668930.sra Read 1985886 spots for SRR9668930.sra Written 1985886 spots for SRR9668930.sra Read 1985886 spots for SRR9668930.sra Written 1985886 spots for SRR9668930.sra Read 1985886 spots for SRR9668930.sra Written 1985886 spots for SRR9668930.sra Read 1985886 spots for SRR9668930.sra Written 1985886 spots for SRR9668930.sra Read 1985886 spots for SRR9668930.sra Written 1985886 spots for SRR9668930.sra Read 1985886 spots for SRR9668930.sra Written 1985886 spots for SRR9668930.sra Read 1985886 spots for SRR9668930.sra Written 1985886 spots for SRR9668930.sra Read 1985886 spots for SRR9668930.sra Written 1985886 spots for SRR9668930.sra Read 1985886 spots for SRR9668930.sra Written 1985886 spots for SRR9668930.sra Read 1985886 spots for SRR9668930.sra Written 1985886 spots for SRR9668930.sra Read 1985886 spots for SRR9668930.sra Written 1985886 spots for SRR9668930.sra Read 1985886 spots for SRR9668930.sra Written 1985886 spots for SRR9668930.sra Read 1985886 spots for SRR9668930.sra Written 1985886 spots for SRR9668930.sra SRR ids: ['SRR9668930.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_44c6p2ii SRR9668930.sra spots: 39717720 blocks: [[1, 1985886], [1985887, 3971772], [3971773, 5957658], [5957659, 7943544], [7943545, 9929430], [9929431, 11915316], [11915317, 13901202], [13901203, 15887088], [15887089, 17872974], [17872975, 19858860], [19858861, 21844746], [21844747, 23830632], [23830633, 25816518], [25816519, 27802404], [27802405, 29788290], [29788291, 31774176], [31774177, 33760062], [33760063, 35745948], [35745949, 37731834], [37731835, 39717720]] SRR9668930 file size 7541745 SRR9668930 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR9668930 SRR9668930_1.fastq SRR9668930_2.fastq Input file: SRR9668930_1.fastq Paired file: SRR9668930_2.fastq trimmed: SRR9668930-trimmed-pair1.fastq, SRR9668930-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 17:01:39 2025 >> started Wed Feb 12 17:02:35 2025 >> done (56.621s) 39717720 read pairs processed; of these: 25 ( 0.00%) short read pairs filtered out after trimming by size control 5229 ( 0.01%) empty read pairs filtered out after trimming by size control 39712466 (99.99%) read pairs available; of these: 8017 ( 0.02%) trimmed read pairs available after processing 39704449 (99.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 5 0.00% 20 0 0.00% 21 3 0.00% 22 6 0.00% 23 9 0.00% 24 15 0.00% 25 14 0.00% 26 31 0.00% 27 33 0.00% 28 20 0.00% 29 39 0.00% 30 51 0.00% 31 45 0.00% 32 49 0.00% 33 68 0.00% 34 51 0.00% 35 175 0.00% 36 219 0.00% 37 260 0.00% 38 277 0.00% 39 292 0.00% 40 282 0.00% 41 363 0.00% 42 331 0.00% 43 433 0.00% 44 478 0.00% 45 442 0.00% 46 441 0.00% 47 560 0.00% 48 693 0.00% 49 792 0.00% 50 876 0.00% 51 1134 0.00% 52 1183 0.00% 53 1162 0.00% 54 1318 0.00% 55 1742 0.00% 56 1775 0.00% 57 1976 0.00% 58 2278 0.01% 59 2335 0.01% 60 2721 0.01% 61 2825 0.01% 62 3334 0.01% 63 3661 0.01% 64 3901 0.01% 65 4312 0.01% 66 4592 0.01% 67 5103 0.01% 68 5344 0.01% 69 5944 0.01% 70 7841 0.02% 71 10920 0.03% 72 31655 0.08% 73 347528 0.88% 74 3267067 8.23% 75 19213657 48.38% 76 16769805 42.23% 39712466 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=26 prefix-density=0.51 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTGTTGCGAAGAAGGTACTCAATTTCCTGGGCCAATTGCTCAGTAGTGAGATCTGG criterion=fanout-score sequence-density=0.08 sequence-density-rank=24 fanout-score=14.77 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=4.4 sequence=CCATCTTTCGGCTAACCTAGCCTCCTCCGTCCCTCGGGACCAACAAGGGGTAGTACAGGAATATTCGCCTGTTGTCCATCGACTACGCCTTTCGGCCTGATCTTAGGCCCTGACTCACCCTCCGTGGACGAACCTTGCGGAGGAACCCTTAGGTTTTCGGGGCATTGGATTCTCACCAATGTTTGCGTTACTCAAGCCGACATTCTCGCTTCCGCTTCGTCCACCCCCGCTCGCGCGGGTGCTTCCCTCTAAGCGGAACGCTCCCCTACCGATGCATTTTTACATCCCACAGCTTCGGCAGATCGCTTAGCCCCGTTCATCTTCGGCGCAAGAGCGCTCGATCAGTGAGCTATTACGCACTCTTTCAAGGGTGGCTGCTTCTAGGCAAACCTCCTGGCTGTCTCTGCACCCCTACCTCCTTTATCACTGAGCGGTCATTTAGGGGCCTTAGCTGGTGATCCGGGCTGTTTCCCTCTCGACGATGAAGCTTATCCCCCACCGTCTCACTGGC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=22 prefix-density=0.43 prefix-fanout=2.0 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=23.22 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.2 sequence=AAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGG SRR9668930 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 17:03:12 Started mapping on | Feb 12 17:03:12 Finished on | Feb 12 17:05:55 Mapping speed, Million of reads per hour | 877.09 Number of input reads | 39712466 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 34547599 Uniquely mapped reads % | 86.99% Average mapped length | 150.39 Number of splices: Total | 15292150 Number of splices: Annotated (sjdb) | 15123151 Number of splices: GT/AG | 15011261 Number of splices: GC/AG | 241062 Number of splices: AT/AC | 10183 Number of splices: Non-canonical | 29644 Mismatch rate per base, % | 0.48% Deletion rate per base | 0.02% Deletion average length | 2.18 Insertion rate per base | 0.01% Insertion average length | 2.05 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1565363 % of reads mapped to multiple loci | 3.94% Number of reads mapped to too many loci | 2065012 % of reads mapped to too many loci | 5.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.61% % of reads unmapped: other | 0.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3599572 3599572 3599572 N_multimapping 1565363 1565363 1565363 N_noFeature 1335644 34113966 1455624 N_ambiguous 491724 1983 176465 UnstrandedReadsAssigned:32720231 PositiveStrandReadsAssigned:431650 NegativeStrandReadsAssigned:32915510 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR9668930 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR9668930-trimmed-pair1.fastq SRR9668930-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 39,712,466 reads, 35,197,147 reads pseudoaligned [quant] estimated average fragment length: 198.399 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,188 rounds 52401 SRR9668930.ke.tsv 34699 SRR9668930.se.tsv 87100 total ==> SRR9668930.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1820.6 771 10.6455 Potri.005G024800.1.v4.1 1035 837.601 151 4.53175 Potri.004G059700.1.v4.1 961 763.601 57 1.87644 Potri.007G009000.2.v4.1 1416 1218.6 0 0 Potri.003G141000.2.v4.1 2943 2745.6 706.491 6.46838 Potri.016G087400.1.v4.1 270 89.3139 2091.01 588.522 Potri.015G069301.1.v4.1 564 366.786 0 0 Potri.010G195200.1.v4.1 1773 1575.6 7 0.111681 Potri.012G127500.1.v4.1 977 779.601 7673 247.411 ==> SRR9668930.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 44 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 560 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 212 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 16 SRR9668930 completed mapping pipeline successfully